Xref: utzoo sci.bio:2108 sci.med:10969
Path: utzoo!utgpu!jarvis.csri.toronto.edu!rutgers!sunybcs!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Newsgroups: sci.bio,sci.med
Subject: Re: references on multiple sequencing to reduce the error rate
Keywords: Maxam-Gilbert, Sanger, nucleic acid, sequencing
Message-ID: <9837@boulder.Colorado.EDU>
Date: 3 Jul 89 21:52:11 GMT
References: <27540@beta.lanl.gov>
Sender: news@boulder.Colorado.EDU
Reply-To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Organization: University of Colorado, Boulder
Lines: 34

In article <27540@beta.lanl.gov> dd@beta.lanl.gov (Dan Davison) writes:
>
>The general idea is that even if your gels are clean, banding perfect,
>and all those other unlikely things, the chemical and dideoxy methods
>will have a certain error rate.  This is generally, but not entirely,
>due to misincorporation of the ddNTPs by the Klenow or other polymerase
>(for the dideoxy method) or random non-specific cleavage (chemical
>method).  

I think errors in sequencing are more often the result of errors made 
prior to the actual sequencing reaction.  Even if the ddNTP method 
randomly misincorporates at a certain frequency, it is usually easy
to see the ambiguity because, say lane A has a band and so does G, you
know you have a problem.  A more serious problem lies in cDNA clones
which rely on reverse transcriptase (a notoriously sloppy enzyme).  If
the clone you pick from your library happens to have a "miscopied"  
base, your sequencing reactions will be clear as day and there will
still be a mistake in the sequence.  The became painfully clear to 
us when we found a stop codon right in the middle of our longest clone
of human beta-casein.  We were already comming up with theories on 
suppressor tRNA's in mammary tissue before we sequenced other clones
and realized it was just a glitch from reverse transcriptase. With the
growing popularity of PCR, I am sure a lot of people are going to get
stung due to the high error rate of Taq polymerase (misincorportation
rate about 1 in 1000 bases).  
 
-------------------------------------------------------------------------
AAGGTGCAATGATGAGGAATTTTATCGTAGTTATGAATAATCCTGCAAGAGGTGCAAAACCCAGAGTACCTCA
Eric E. Snyder
Department of Molecular,              I thought it was rain for a minute;
 Cellular and Developmental Biology   I thought the game had been called.
University of Colorado, Boulder
TTCCACGTTACTACTCCTTAAAATAGCATCAATACTTATTAGGACGTTCTCCACGTTTTGGGTCTCATGGAGT
-------------------------------------------------------------------------