Path: utzoo!attcan!uunet!tut.cis.ohio-state.edu!cica!gatech!ncar!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Newsgroups: sci.bio
Subject: GGR expression in tryptophan auxotroph media
Message-ID: <10756@boulder.Colorado.EDU>
Date: 14 Aug 89 21:45:37 GMT
Sender: news@boulder.Colorado.EDU
Reply-To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Organization: University of Colorado, Boulder
Lines: 16

I am currently trying to express a mutant _E. coli._ galactose receptor in a 
derivative of pUC19 in tryptophan auxotroph media for 19F-trp labeling for
NMR.  Unfortunately, our new mutants (all trp -> tyr) are not being expressed
in our usual M9 + casamino acids media.  All our other mutants grow well in
LB and express GGR as well as the wild-type plasmid.  

Any ideas???

-------------------------------------------------------------------------
AAGGTGCAATGATGAGGAATTTTATCGTAGTTATGAATAATCCTGCAAGAGGTGCAAAACCCAGAGTACCTCA
Eric E. Snyder
Department of Molecular,              I thought it was rain for a minute;
 Cellular and Developmental Biology   I thought the game had been called.
University of Colorado, Boulder
TTCCACGTTACTACTCCTTAAAATAGCATCAATACTTATTAGGACGTTCTCCACGTTTTGGGTCTCATGGAGT
-------------------------------------------------------------------------