Path: utzoo!attcan!utgpu!jarvis.csri.toronto.edu!mailrus!ncar!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Newsgroups: sci.bio
Subject: Re: Question about Ferilization Genetics
Message-ID: <11289@boulder.Colorado.EDU>
Date: 2 Sep 89 16:17:56 GMT
References: <5760@ttidca.TTI.COM>
Sender: news@boulder.Colorado.EDU
Reply-To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Distribution: usa
Organization: University of Colorado, Boulder
Lines: 24

In article <5760@ttidca.TTI.COM> jackson@ttidca.tti.com (Dick Jackson) writes:
>My girlfriend and I had this big argument -- I am hoping that at least one
>good person in this group will help settle it.
>
>Its about the variability in offspring from the same parents.  I claimed
>that eggs and sperm from the same people contain identical genetic
>material and that variations in offspring occur because of semi-random
>combination when fertilization occurs.  She maintains that sperm and eggs
>are all different at the gene level.

"Crossing over" occurs during the pachytene and diplotene stages of meiotic
prophase and thus genetic variation is present in both egg and sperm. When
egg and sperm pool their genes to for the zygote, no further recombination
occurs.... if recombination could occur at each mitotic division, we would
be pretty scary looking....!

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGATTCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                             I love this mansion,
Department of Biochemistry                 'though it's too many windows
University of Colorado, Boulder            to open half-way each morning
Boulder, Colorado 80309                    to close half-way each night.
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------