Path: utzoo!attcan!utgpu!jarvis.csri.toronto.edu!mailrus!ncar!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Newsgroups: sci.bio
Subject: Re: Question about Ferilization Genetics
Message-ID: <11299@boulder.Colorado.EDU>
Date: 2 Sep 89 23:59:21 GMT
References: <5760@ttidca.TTI.COM> <9613@eerie.acsu.Buffalo.EDU>
Sender: news@boulder.Colorado.EDU
Reply-To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Distribution: usa
Organization: University of Colorado, Boulder
Lines: 25

In article <9613@eerie.acsu.Buffalo.EDU> dmark@joey.UUCP (David Mark) writes:
>
>For diploid species like us and many other higher animals, each sperm cell
>contains exactly half of the genes of the ordinary cells of the male; 
>however, it is a "more-or-less" random selection, one allele of each pair
>of genes.  If there were 100 genes, there would be some 2^100 different
>sperm cells.  And, there are way more than 100 genes!!  The same goes for
>the eggs for diploid species.
>
This is misleading.... Genes are not partitioned randomly; chromosomes are.
Thus, assuming no recombination, there would be 2^23 different permutations
of chromosome distribution in humans (haploid genome = 23 chromosomes).  That
is a large number (about 8 million) but not as large as 2^(the number of genes)
Unfortunately, meiotic crossing-over complicates the picture
considerably.....

Thanks to ted@NMSU.Edu for correcting my math the first time 'round.
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGATTCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                             I love this mansion,
Department of Biochemistry                 'though it's too many windows
University of Colorado, Boulder            to open half-way each morning
Boulder, Colorado 80309                    to close half-way each night.
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------