Path: utzoo!attcan!utgpu!jarvis.csri.toronto.edu!mailrus!ncar!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Newsgroups: sci.bio
Subject: Re: Creating life
Keywords: Life
Message-ID: <13488@boulder.Colorado.EDU>
Date: 3 Nov 89 16:42:34 GMT
References: <2461@umbc3.UMBC.EDU> <4516@utastro.UUCP> <2189@hudson.acc.virginia.edu> <19690@brunix.UUCP>
Sender: news@boulder.Colorado.EDU
Reply-To: eesnyder@beagle.Colorado.EDU (Eric E. Snyder)
Distribution: usa
Organization: University of Colorado, Boulder
Lines: 24

In article <19690@brunix.UUCP> jda@cslab9a.UUCP (Jeff Achter) writes:
>
>Additionally, we don't know how the transcription enzymes
>know when to start and stop transcribing a stretch of DNA.  There are
>three possible reading frames on each of the two complementary
>strands; which will be expressed?  Until we know this, we can't
>reliably craft a genome.

Come now, we deserved a little more credit than that.  I suggest the 
following reference:

Pribnow, D. (1975)  Nucleotide sequence of an RNA polymerase binding site
at an early T7 promoter.  PNAS 72(3): 784-788.

I hope the name rings a bell.

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of Biochemistry              Proctoscopy recapitulates   
University of Colorado, Boulder         hagiography.            
Boulder, Colorado 80309                  
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------