Path: utzoo!utgpu!news-server.csri.toronto.edu!rutgers!uwm.edu!zaphod.mps.ohio-state.edu!sunybcs!boulder!eesnyder From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder) Newsgroups: sci.bio Subject: Re: DNA Purification Message-ID: <22785@boulder.Colorado.EDU> Date: 27 Jun 90 03:15:46 GMT References: <1990Jun26.232707.20681@athena.mit.edu> Sender: news@boulder.Colorado.EDU Reply-To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder) Organization: University of Colorado, Boulder Lines: 42 In article <1990Jun26.232707.20681@athena.mit.edu> whycare@athena.mit.edu (nemo) writes: >In an article written by a member of Bethesda Research Laboratories, I >read the following generalized description for partially purifying DNA >for restriction endonuclease digestion: > >"Before reaction, remove these (tightly associated molecules such as >protein and ethidium bromide) by chloroform/phenol extraction and/or >ethanol precipitation >from high salt (2.5 M ammonium acetate)." > >The chloroform and phenol, I think, break up the proteins into their > amino acid constituents, which then are trapped in the upper phase > of the resulting mixture. But I'm not sure why the >amino acids end up in the upper phase. Actually, the phenol simply denatures the proteins so that when microfuged they precipitate and collect at the interface. This will become obvious once you try it. So you take the aqueous layer and leave the white gunk (the denatured protein) behind.... > I don't understand how the DNA and protein >would phase out in solution and what the function of the high salt >concentration.... The DNA stays in aqueous solution because it is a polyanion and does not need a particular secondary structure to be hydrophilic. Increasing the salt concentration doesn't make a lot of difference in water but greatly reduces the solubility of DNA in EtOH, a less polar solvent that water. As a result, the DNA crashes out when you add alcohol, the phenol and CHCl3 doesn't and you now have "pure" DNA (and probably RNA). Check out the new Maniatis, _Handbook of Molecular Cloning_ or some such; it is Bible of Mol. Bio. --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of Biochemistry Proctoscopy recapitulates University of Colorado, Boulder hagiography. Boulder, Colorado 80309-0215 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------