Path: utzoo!utgpu!news-server.csri.toronto.edu!cs.utexas.edu!sun-barr!olivea!samsung!emory!gatech!ncar!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Newsgroups: sci.bio
Subject: Flowering plants
Message-ID: <28272@boulder.Colorado.EDU>
Date: 17 Oct 90 14:23:30 GMT
Sender: news@boulder.Colorado.EDU
Reply-To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Organization: University of Colorado, Boulder
Lines: 19

A friend of mine came up with a statement that struck me a patently
absurd....

"there is no evidence of angiosperms (flowering plants) in the 
fossil record"

I feel an little embarrased asking but, is this true?  On a related
note: there was a paper (in Nature?) recently in which a cytochrome
gene was PCR'd from a fossilized plant... was this a flowering plant?
(and does anyone have a ref?)....

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology            We are not suspicious enough 
University of Colorado, Boulder      of words, and calamity strikes.
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------