Xref: utzoo sci.chem:2592 sci.bio:3972
Path: utzoo!utgpu!news-server.csri.toronto.edu!cs.utexas.edu!usc!elroy.jpl.nasa.gov!ncar!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Newsgroups: sci.chem,sci.bio
Subject: Re: Blood and detecting "Pool P"
Message-ID: <30269@boulder.Colorado.EDU>
Date: 27 Nov 90 03:25:32 GMT
References: <1990Nov10.021059.16136@morrow.stanford.edu> <1990Nov25.154239.17434@phri.nyu.edu> <4200@kitty.UUCP>
Sender: news@boulder.Colorado.EDU
Reply-To: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Organization: University of Colorado, Boulder
Lines: 21
Nntp-Posting-Host: beagle.colorado.edu

In article <4200@kitty.UUCP> larry@kitty.UUCP (Larry Lippman) writes:
>In article <1990Nov25.154239.17434@phri.nyu.edu>, roy@phri.nyu.edu (Roy Smith) writes:
>> 	Would it be possible to recover enough DNA to do PCR on it?
>
>	I don't believe that any DNA fragments would exist in the dry
>condition of a 300-year old blood stain.....

I bet there would be PCRable DNA fragments....  Remember that DNA is 
a remarkably stable molecule (even in my hands).  Furthermore, PCR only
requires a few molecules of template to give a signal... that is not too
much to ask.  One could easily do species ID by selecting a highly 
polymorphic locus such as beta-casein and sequencing the amplified 
product.  
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology            We are not suspicious enough 
University of Colorado, Boulder      of words, and calamity strikes.
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------