Path: utzoo!utgpu!watserv1!watmath!uunet!mcsun!ukc!mrccrc!gwilliam From: gwilliam@crc.ac.uk (Gary Williams x3294) Newsgroups: bionet.molbio.genome-program Subject: GNOME-NEWS No. 5 (long!) Keywords: human genome mapping project newsletter Message-ID: <513@tin.crc.ac.uk> Date: 8 Mar 91 20:07:47 GMT Organization: MRC Human Genome Mapping Project Resource Centre, Harrow, U.K. Lines: 2580 G-NOME NEWS ----------- The Newsletter of the UK Human Genome Mapping Project Number 5 Winter 1991/91 Editors: Nigel K. Spurr Enquiries to: Nigel K. Spurr, ICRF Clare Hall Laboratories, Blanche Lane, Potters Bar, South Mimms, Herts. EN6 3LD Tel: 0707-44444, Ext. 353 Contents: Page No. 1) Editorial - Nigel Spurr 2 2) Call for Contributions 3 3) HGMP Resource Centre - Tony Vickers 4 4) The Human Cell Bank at CAMR, Porton 7 5) European Community Human Genome Analysis Programme 9 6) HGMP Senior Fellowship 11 7) Human Genome and Related Research in London 12 i) MRC Clinical Research Centre 12 ii) Imperial Cancer Research Fund 17 a. Director's Laboratory b. Laboratory of Human Molecular Genetics c. Human Immunogenetics Laboratory d. Genome Analysis Laboratory e. Human Cytogenetics Laboratory f. Molecular Analysis of Mammalian Mutation Laboratory iii) Research Interests at Charing Cross 20 iv) St. Bartholomew's Hospital 20 v) St. Mary's Hospital Medical School 20 vi) Institute of Child Health 22 vii) Mount Vernon Hospital 23 viii) The Galton Laboratory, University College London 23 ix) University College & Middlesex School of Medicine 25 a. Department of Psychiatry b. Department of Medicine x) Royal Postgraduate Medical School, Hammersmith Hospital 26 xi) United Medical and Dental Schools of Guy's and St. Thomas's Hospitals 27 xii) Institute of Neurology 29 xiii) London School of Hygiene and Tropical Medicine 29 xiv) Imperial College of Science Technology and Medicine 29 8) The European Collaborative Interspecific Backcross - A Facility 31 for Mapping the Mouse Genome - Stephen Brown 9) Oligonucleotide Primers for PCR Analysis of Mouse 33 Microsatellites - John Todd 10) Directed Programme Awarded Project Grants - Dr. Furzana Bayri 34 11) 1991 HGMP Research Studentship Awards 36 Appendix I: List of contributors 38 Appendix II: Mouse Chromosome Specific Microsatellites table 42 1) EDITORIAL Nigel Spurr Imperial Cancer Research Fund Clare Hall Laboratories Blanche Lane South Mimms, Potters Bar, Herts. EN6 3LD G-NOME News has now reached its fifth issue and has been well received in the Human Genome Mapping Project community. We also have a larger readership with many diverse interests. At present, it is still a UK venture though the mailing list now has nearly 600 names including many individuals and groups in the rest of Europe and the USA. To acknowledge the increasing readership and influence of the European Community and the establishment of the EC Genetic Analysis programme the next issue will concentrate on research in the rest of Europe. Already many contributions have been received for this issue. The current edition concentrates on research interests in London. The reports cover a wide range of interests and I have not attempted to write any text unifying them. They stand as short reports of current research and show both a high level of activity in the mapping of specific disease genes as well as methods to order and link clones along specific chromosomes. This year the 11th International Workshop on Human Gene Mapping meeting will take place in London, 18-22 August. Further details on abstracts and attendance will follow in the next Newsletter. There are a limited number of places available, around 750, and attendance will be by the acceptance of an abstract only. This obviously will be a major opportunity to show the world community the depth and quality of human genome research in Europe. In the next two months, the HGMP Resource Centre based at the CRC, Northwick Park, will have a number of new facilities available. These are outlined elsewhere in this Newsletter. The UK DNA Probe Bank has now been completely transferred from ICRF Clare Hall to the HGMP Resource Centre. A number of samples have been sent out and catalogues listing the 600 plus probes are now available in a printed form or on-line at the Resource Centre via JANET. Similarly an oligonucleotide primer synthesis has been established and a YAC screening and cDNA cloning and sequencing services are scheduled to follow soon. My thanks in particular go to John Todd and his colleagues in Oxford for allowing us to publish a selection of oligonucleotide primer pairs detecting highly informative mouse microsatellites. There are approximately two primer sets for each mouse chromosome, some unpublished previously and these are being used as index/reference/anchor markers for the mouse genetic linkage map currently under construction (see article on European collaborative project by Steve Brown). All of these primers will be available free to UK registered users; for those interested outside the UK, it is anticipated that the primers will be available in a kit for purchase in the next few months. For further information contact Dr. Gabrielle Fisher at the HGMP Resource Centre (Tel.No: 081-869 3446). If you wish to contribute articles for publication in the Newsletter, please send your contributions as detailed in Section 2 below. These can be useful primer sequences for PCR, technical tips, technique modifications etc. or articles of general interest to the HGMP community. One area where I have been asked to solicit articles is from the recipients of Human Genome Project grants from the MRC. These will outline the use to which these have been put and any valuable developments coming from this extra funding. We are also aiming to produce a series of articles on particular techniques including strengths and weaknesses. The next issue will contain articles on mutation analysis. If you have a novel technique or are interested in contributing to these articles please contact me as soon as possible. Finally may I wish everyone a happy and successful New Year. 2) CALL FOR CONTRIBUTIONS The UK Human Genome Mapping Project would welcome contributions from the HG community, to their quarterly newsletter, G-NOME NEWS. Please send any articles to Dr. Nigel Spurr, ICRF, Clare Hall Laboratories, Blanche Lane, South Mimms, Herts, EN6 3LD. Contributions can be accepted in any form viz: written, fax (0707-49527), disc (any format, but preferably 3.5" discs), or by e-mail (N_Spurr @ UK.AC.ICRF). The deadlines for receipt of copy are as follows: Winter Spring Summer Autumn 10.1.91 9.4.91 10.7.91 10.10.91 3) HGMP RESOURCE CENTRE Recent developments in the services offered from the Resource Centre have been reported in notes circulated to all registered users. As things evolve, this issuing of notes will continue and the quarterly publication of G-NOME NEWS will be used to sum up the position. We are worried by reports that there are still pockets of workers totally unaware of the existence of the Resource Centre (or perhaps even of the HGMP). There are certainly more-or-less major departments in which either no-one has registered or the sole registered user is the head of department. Our hope is that everyone - from graduate students to Fellows of the Royal Society - with a significant interest in the human genome will register; even if they do not want to use anything we have (or will have) to offer, at least we can get them on our mailing list. Registration forms are available from Christine Bates (081-869 3446) or Joanne Grewcock (081-869 3805). Yac libraries We now have the St. Louis library at the Resource Centre, and during January the ICI library will be brought here too. Kay Davies and David Bentley are developing the screening technology, and everything is on course for us to meet the specified objective of having a screening service on-stream by the end of February. David Bentley's group report on their approach to YAC screening in this present issue of G-NOME NEWS. Until the service is launched, we can offer a B-test service on a limited scale: telephone Ross Sibson on 081-869 3803. The European Community Genome Analysis Programme is funding free-of-charge screening by five groups: CEPH, ICRF, Pavia, Leiden and the Resource Centre. All screening data will be accumulated in a single database. CEPH will issue DNA pools of their own library; ICRF will issue gridded filters of DNA from the Lehrach/Monaco library, Pavia and Leiden will offer screening of libraries as yet undetermined (probably the St. Louis one); the Resource Centre will offer in-house screening using the St. Louis and ICI libraries. The centres will be paid by the EC for the screenings they actually do, and we are all waiting for Brussels to issue the contracts and authorizations for the service to begin and for the money to start flowing. It is obviously important that full use is made of this EC-funded service. Unfortunately, the imminent availability of this reimbursement means that owners of libraries may be unenthusiastic about doing screening for people at the moment. Computing At long last, we have the licence to run GDB. The recent X-Chromosome Workshop organized by Kay Davies and Ian Craig in Oxford gave a chance to try out the system in more natural circumstances than at HGM10.5. We have a programme of one-day training courses in the routine use of GDB (and OMIM and GBase). Mary Jennings and Julia White from the HGM11 team are running these courses, which are prefaced by a day's introductory course, about the use of the Resource Centre's facilities generally, for those who are unfamiliar with the system. The two run so far depended on direct access to GDB in Baltimore via the so-called "Fat Pipe" trans-Atlantic link, which distinguished itself on each occasion by springing a leak (at the US end). Now we have GDB at the Resource Centre, those problems should be just bad memories. The problem of editing access - for Chairs and Co-chairs of the Chromosome committees - remains a cause of some concern. If the objective of getting data entered more-or-less continuously, rather than at biennial jamborees, is to be attained, procedures and practices are going to have to be defined a good deal more precisely than at present. The apparent fraility of the Fat Pipe is another worry if editing access requires reliable contact direct with Baltimore. Although HGM10.5 was accounted a success, it was perhaps over-optimistic to assume that everyone would be able to go away and use the system, confident both of their own competence and of the robustness of the system. We are planning a workshop for European Chairs and Co-chairs, to establish a 'real-world' familiarity with the system. All those we have identified will receive an invitation. For information about these courses (and the continuations of the longer courses previously run in Cambridge but now at Northwick Park) phone Christine Bates on 081-869 3446. We are grateful to the officers of Johns Hopkins University and the Medical Institute for providing the licence to run GDB and to reproduce the manuals. The Resource Centre's own computing manual has just been revised and substantially rewritten and increased in scope; the earlier version does not cover all the facilities now on offer. The Resource Centre manuals will be sent to registered users shortly; the GDB manual is a large volume that is very expensive to reproduce, and we shall send one copy to each department, additional copies will be available at a cost of #15 each (including postage and packing). HUMAN GENOME MAPPING WORKSHOPS HGM10.5 was held in Oxford last year and will be followed by HGM11 in London during the summer of this year. The UK HGMP has recently made a substantial contribution to the costs of the computing developments needed to run these meetings, and, especially, to launch GDB at HGM10.5. The Wellcome Trust has very generously agreed to share with the Council the expense of this subvention. RESOURCE SHARING Do you have probes, cell-lines or whatever to share? HGMP grant-holders are required to share data and resources, as one of the conditions of these awards. In many cases, the sole (or a major) reason for the award has been precisely to generate accessible resources. It would be nice not to have to chase people. There is no formal definition of how long someone can have private use of resources they generate with HGMP funding. Certainly, once the work is published the resources have to be made available without delay. Where the purpose of the award was to provide resources, then the contract requires them to be passed on as soon as practicable. John Todd's mouse microsatellite primers are a case in point, where rapid delivery has been achieved. Please let us know (ideally by fax on 081-869 3807) if and when you have resources to share. CHROMOSOME 11 Recently, Veronica van Heyningen, David Porteous and David St. Clair - all of the Human Genetics Unit in Edinburgh - have floated some specific ideas for co-ordinating work on chromosome 11: the aim is "to further the communication of information, nurture collaborations and avoid redundancy of effort". Specific initiatives include establishing a panel of break-point hybrids for regional mapping (such as already exist for some other chromosomes, eg. 21); exchanging information about probes and other reagents; and identifying as many as possible of the people with an interest in the chromosome. For further information, contact one of the above: the Unit's telephone number is 031-332 2471 and fax 031-343 2620. Cataloguing and documentation of probes, cell-lines and whatever are problems that the two Resources Subcommittees of the Joint Scientific Advisory Board identified almost two years ago. We are addressing them in the specific context of the collection of cytogenetic abnormalities being organized by Maggie Fitchett at Oxford, as a joint exercise between the HGMP and the Association of Clinical Cytogeneticists. The objective is to have a standard cheap-and-cheerful user-friendly format of database that can be made available in a run-time version for anyone who wants to have a simple PC-based cataloguing system. This is not a particularly exciting concept in computing terms: if your computing expert wants to set up your database in anything more interesting (Sybase, Oracle or whatever) ask beforehand what the total bill will be (and get the reply in writing) and find out why something simple will not serve the purpose. EQUIPMENT Having spent six years, since emerging from the peace of MRC Headquarters, in managing research groups, I have been especially intrigued by the relationship between equipment manufacturers and scientists. A nice example was when one of the groups purchased a major item, costing 50,000 Pounds or so. For months the scientists struggled to make it work; the psychodynamics were that the manufacturer effortlessly established dominance: the scientists unquestioningly accepted that the machine's non-performance was their own fault and that making it work was their responsibility. Any suggestion that the machine or the design might be inherently defective was met by the retort that X and Y had bought machines and were delighted with them. The time came when I telephoned X and Y and found that they had both failed to make their machines work and had simply let the matter rest there without protest. In other words, each had, in effect, written off 50,000 Pounds just like that. Armed with that information - and despite pleas of the "Let's give it another month ..." sort, we went to the manufacturer and insisted that they make materials to a reasonable specification on our machine; when that exercise failed, the challenge moved to their carrying out the exercise on one of their own machines. When that in turn was a total flop, we successfully demanded our money back, with compensation for all the wasted time and reagents. But it was made clear to us that we were not behaving in the spirit of the game. My interest has been acute whilst the Resource Centre has been kitted out. Sadly, it has been the exception rather than the rule for anything to work faultlessly from the word go. Some pieces of equipment could not possibly ever have worked. Others have worked acceptably only after repeated visits from service engineers. Others break down repeatedly. The implication is that the user is the quality control. Any manufacturer of household appliances or cars who took such an attitude these days would rapidly go out of business. Yet the prices of most items could be justified only by Rolls-Royce quality of design and engineering. There have been some shining exceptions to these criticisms. That, in itself, makes the failures all the more depressing. Other sources of interest are manufacturers who include in warranties, clauses that try to exclude the customer's normal legal rights; again, that cavalier attitude has long since been unacceptable in the everyday world and would probably not stand up in court. The Consumers Association would have a field day with the scientific equipment industry. It may be that there is a place for a "Which?" in the laboratory. If anyone has good stories that might save others wasting time and money, telephone Clive Gilchrist at the Resource Centre (081-869 3535). 4) THE HUMAN CELL BANK AT CAMR, PORTON The Human Cell Bank began to operate with funding from the HGMP in May last year. A Liaison Committee has been set up to monitor the Bank's operations and advise management both of the Bank and of the HGMP; the scientific members are Gary Brown, Malcolm Ferguson-Smith, Veronica van Heyningen and Bob Williamson. It became clear that the greatest immediate interest was in the transformation service and that the biggest users were people who wanted to establish large numbers of cell-lines from disease-families. Although the Project Management Committee accepted that a Human Cell Bank be funded, they were always concerned that the use of the funding should be for purposes central to the interests of the HGMP; establishing large collections of disease-families was something that was of dubious value as a communal resource (although it was accepted that there was something to be said for everyone interested in a particular disease using the same families). We let the unrestricted access run for a while, with the explicit warning that we might have to limit free-of-charge access if the volume of traffic got too great. That proved to be the case, and the Project Management Committee, advised by the Directed Programme Committee and by the Liaison Committee for the Cell Bank, have decided that the ground-rules set out below should apply. 1. The Human Cell Bank is an organization independent of the HGMP, and it can supply services and cells to anyone who is prepared to pay: for details of services and charges, apply directly to the Bank at the PHLS Centre for Applied Microbiology and Research, Porton Down, SALISBURY, Wilts. SP4 0JG (Tel: 0980-610391; Fax: 0980-611315). 2. To use the preferential terms applying to HGMP users, you must be a registered user (and accept the consequential obligations). 3. Small requirements - say up to 10 transformations a year - will be dealt with on a de minimis basis and normally dealt with free of charge. 4. People providing cytogenetic abnormalities, eg. as part of the ACC collection, will have the blood sample processed and lymphocytes stored (free-of-charge, of course); periodically, a Panel, made up of HGMP scientific nominees on the Liaison Committee will consider the list of accessions and decide which of the cells should be transformed. The depositor will receive an ampoule of transformed cells, as a quid pro quo, and the line will be put in the catalogue for distribution. 5. Those wishing to make extensive use of the transformation service, eg. from disease-families, should make a written proposal to the Resource Centre, indicating how many samples are proposed over what time-span and arguing a scientific case, in terms, for example, of the benefits of having a collection of cells from the disease in question. The Liaison Committee Panel will then decide whether the specimens should be transformed free-of-charge, or a charge of #25 per sample made, or the full list price for the service charged. In each case, the costs of packing and delivery will be charged to the customer. 6. Anyone benefiting from the preferential charging structure will be required to allow the lines to be made available to other registered users without constraint and must provide appropriate documentation of the cells. 7. No charges will be levied retrospectively, but samples that have already been deposited but not processed will only be taken as far as the preservation of lymphocytes. The Panel, referred to in section 5 above, is deciding which of the disease-families should be accepted as relevant to the interests of the HGMP. Except insofar as the panel agrees to free-of-charge transformations in a particular case, each depositor will then be asked whether he or she wishes to pay the costs of transformation at a level decided by the Panel (ie. either 25 Pounds per line or the full commercial charge). If not, then the untransformed cells will simply be archived, in case of any future requirement for them. We very much regret having to restrict this service, but at 25 Pounds the charge for transformation is still outstandingly good value for money. THE USERS' MEETING 1991 The Users' Meeting this year will be held on 19th April at the Royal College of Physicians (at the South-east corner of Regent's Park). We plan to begin at 11 o'clock, with a scientific programme in the morning, concentrating on presentations from HGMP award-holders. After a buffet lunch, there will be a guest lecture, followed by presentations and discussions about topics such as single chromosome workshops, the US and EC programmes, the developing cDNA programme, and so on. All registered users will shortly get an invitation. 5) EUROPEAN COMMUNITY HUMAN GENOME ANALYSIS PROGRAMME The January 15 1991 deadline for submission of applications in response to the 'open call for proposals' has now passed, but applications to the training programme can be made at any time. This article provides a brief explanation of the training programme for the EC Human Genome Analysis Programme. Scope of the EC Human Genome Analysis Programme * Improvement of the human genetic map; collection and mapping of the DNA of large families, in order to provide well-characterised genetic material and sets of probes to determine the location of the relative position of genes on the chromosomes * Physical mapping and ordered clone libraries of the human genome; cosmid libraries of human chromosomes; screening of YAC libraries from the human genome; establishing overlapping clone libraries; (limited) sequencing of cDNA * Improvement of the methods and basis for the study of the human genome - (eg. technologies to facilitate genetic mapping; techniques for long-range physical mapping; interpretation of the biological or clinical significance of human genome data; methods for specific diagnosis of severe genetic defects) * Databases useful for human genome analysis (eg. for genetic and physical maps, ordered clone libraries and sequences); software tools for data analysis and database access; novel computing methods for data interpretation Aims of the training programme * to promote and develop the training of young European scientists * to facilitate the exchange know-how between laboratories interested in analysing the human genome * to establish collaborative contacts between laboratories in order to reinforce the transfer of advanced technologies into laboratories, in particular to Member States in which these techniques are currently underdeveloped. Financial support Financial support will be in the form of * BURSARIES to researchers, accompanied by SUBSIDIES to the host institutions; for a period up to 2 years maximum. * GRANTS to institutions playing host to the research workers. A bursary consists of a flat rate monthly sum designed to cover the mobility and subsistence expenses of the bursary-holder. Two types of bursary are available: - young scientist, for those who hold a university degree requiring at least four years of study (Diploma in Germany, licence or ingneur civil in Belgium, laurea in Italy, MSc in the UK and Ireland, DEA in France, etc.); - experienced scientist, for those who hold a doctorate or who have at least four years professional experience after completion of the university studies (see paragraph on young scientists). The subsidy accompanying the bursary is paid to the host institution to cover overheads and research expenditure. At least 30% of the subsidy must be set aside to defray the bursary-holder's expenses in connection with missions and/or attendance at relevant European Conferences etc. A 5000 ecu (approx. 3500 Pounds) subsidy is paid in the case of young scientists; 10,000 ecu (approx. 7000 Pounds) in the case of experienced scientists. A grant takes the form of financial support to the host institution, so as to enable a researcher to join a research team for the purpose of carrying out a project. The amount of the grant is set by the Commission, on the basis of a proposal by the host institution and, if necessary, by negotiation. The grant arrangement is particularly suitable for researchers who already have a contract of employment or other income for research work, so that the bulk of the salary costs will be paid by the laboratory from which they originate, and not by the host laboratory. Applicants intending to pursue the grant procedure are strongly advised to discuss their plans with the Commission before submitting an application. Eligibility of candidates * At the moment the grants are awarded only to nationals of the Member States of the European Communities. * The training through research must take place in a country other than the country of origin of the applicant or the country where he/she normally resides (at the time of writing only laboratories located in the Member States of the European Communities can function as host laboratories). Application procedure/further information * Applications may be submitted at any time (submissions arriving before 1 March will be judged in April, submissions arriving before 1 September will be judged in October) * The selection committee will meet twice a year (normally in April and October) A "Guide to sectoral grants in science and technology" is available from the following address: A. Klepsch CEC - DG XII/F6 "Human Genome Analysis" 200, rue de la Loi B - 1049 Brussels tel: 010 322 235 0749 fax: 010 322 235 5365 It contains the general rules governing the scheme for bursaries/subsidies and grants, and one set of application forms. In the UK the Medical Research Council takes the lead for this EC programme, on behalf of the Department of Education and Science. UK readers with general enquiries about the EC Human Genome Analysis programme should contact the International Section Medical Research Council 20 Park Crescent London W1N 4AL fax: 071 436 6179 6) HGMP SENIOR FELLOWSHIP These awards are aimed at providing secure personal employment for a period of six years for exceptionally talented scientists working in the area of genome mapping. These awards are designed to retain in the UK, or attract back from abroad, highly talented scientists by offering them both some degree of personal security and the means to set up their own group. Dr. Peter James Scambler (Department of Biochemistry and Molecular Genetics, St. Mary's Hospital Medical School, London) was awarded an HGMP Senior Fellowship by the HGMP Senior Fellowships Panel in December 1990 to work on a project entitled "Regional and fine mapping of two regions of the human genome associated with aneuploidy syndromes". 7) HUMAN GENOME AND RELATED RESEARCH IN LONDON i) MRC CLINICAL RESEARCH CENTRE Division of Molecular Medicine The molecular genetics of apolipoprotein B (James Scott and colleagues) This part of the Division has a range of interests aimed at understanding the molecular genetics of apolipoprotein (apo) B. Apo B is the principal cholesterol-carrying protein in the blood. Project 1: The apo B gene is unique among nuclear genes in higher eukaryotes, in that the mRNA encoding apo B undergoes editing, which leads to the [production of two forms of apo B that have different roles in the metabolism and transport of lipid in the circulation. The Division is using molecular genetic and biochemical approaches to characterise the editing activity. It is made up of a complex of different proteins and has a necessary RNA component. This editing process presumably reflects an ancient biological process, which must have its origins in other biological mechanisms. The Division pursuing the genes that encode the editing activity in mammals, with the objective of defining the biological origin and importance of this mechanism. Project 2: The Division is concerned with the identification of genes involved in the biosynthesis of apo B-containing lipoproteins. Two distinct genetic abnormalities affect apo B biosynthesis. These are the conditions abetalipoproteinaemia and chylomicron retention disease. Genetic studies have shown that neither of these conditions are due to defects of the apo B gene. Both are considered to be defects of proteins specially required for the biosynthesis and secretion of apo B-containing lipoproteins. Genetic and more traditional biochemical mechanisms are being used to purse these genes. Project 3: The Division is interested in familial combined hyperlipidaemia. This is the commonest inherited abnormality of lipid metabolism. It is responsible for 10% of all episodes of coronary heart disease occurring before the age of 60. It is therefore a major disease problem. The Division has established that despite phenotypic homogeneity, the disorder is caused by major gene abnormalities occurring at at least three loci. We have established that a single allele operating at or near to the apo AI/CIII/AIV locus on chromosome 11q23-q24 is responsible for a substantial subset of individuals with this disorder. Currently the Division is seeking to identify the mutation and other possible mutations causing this disorder. Gain of function operating at the level of transcription of the apo CIII gene is the most likely candidate for the cause of this disorder. In addition, the Division has established that s subset of individuals with defects of the lipoprotein lipase gene have the familial combined hyperlipidaemia phenotype. A significant subset of individuals have defects at neither of these loci, so that candidate genes and highly polymorphic VNTR and microsatellite repeats are being used to purse the other locus or loci. The resources of the human Genome Resource Centre at the Clinical Research Centre are a major asses in pursuing these goals. Greig cephalopolysyndactyly syndrome (Martin FARRALL) Greig cephalopolysyndactyly syndrome (GCPS) is a rare inherited disorder resulting in abnormal craniofacial and limb development and has been localized to human chromosome 7p13. The mouse mutation extra-toes (Xt) is a likely homolog of GCPS. We have commenced a combined human/murine 'reverse genetic' program aiming to clone and characterize the gene(s) mutated in GCPS/Xt. Our human studies include the isolation of clones from a chromosome mediated gene transfer cell line (gift of Julia Dorin and David Porteous, Edinburgh) containing approximately 10 megabases of human chromosome 7p. Our murine studies are focused on YAC cloning in the vicinity of the transgene integration site of the insertionally mutagenised Add mutant (which is allelic to Xt), in collaboration with Uli Rther, EMBL, Hans Lehrach, ICRF and David Burke, Princeton. Mineral and Endocrine Disorders (MED) Group (Raj THAKKER and colleagues) We are investigating the molecular basis of important metabolic and endocrine disorders which affect calcium and phosphate homeostasis. The disorders of calcium homeostasis that are being studied are Multiple Endocrine Neoplasia Type 1 (MEN1) and hypoparathyroidism, and that of phosphate homeostasis is X-linked hypophosphataemic rickets (HYP). We have previously undertaken family linkage studies and have localised the MEN1 gene to chromosome 11q13, the X-linked recessive hypoparathyroidism gene to Xq26-q27 and HYP to Xp22.31-p21.3. This localisation of each of the disease loci represents the first step towards defining the genetic abnormality and in subsequently characterising the disease gene product ie. the protein. Since our initial mapping of these disease loci, we have extended our studies and have undertaken further investigations to identify the genes causing these disorders. Our efforts have been mainly directed towards identifying the mutant gene causing MEN1, and in establishing chromosome 11 linking libraries. Multiple Endocrine Neoplasia Type 1 (MEN1) Men1 is characterised by the combined occurrence of tumours of the parathyroid glands (causing hypercalcaemia), the pancreatic islet cells and the anterior pituitary gland. The disease may arise sporadically or be inherited as an autosomal dominant condition. The genetic abnormalities which cause inherited disorders may involve two or more recessive mutations and these have been investigated in MEN1 using the techniques of molecular biology. Our studies have demonstrated that allelic deletions on chromosome 11 are involved in the monoclonal development of parathyroid tumours, which are the commonest feature of MEN1. In addition, our studies of three affected families established linkage with the oncogene INT2.SS6 (peak LOD score = 3.30, q = 0.00). The MEN1 gene was thus mapped to the pericentomeric region of the long arm of chromosome 11 (11q13). In order to establish a more precise genetic map around the MEN1 locus, we have obtained blood samples from 22 more families with MEN1 and have collected data for a national MEN1 register. Our present collection of 25 MEN1 families represents the largest series in the world and provides a valuable resource for further molecular genetic and endocrine studies of MEN1. We are currently using 17 polymorphic DNA probes from 11q13 to define a precise genetic map around MEN1. We are also pursuing deletion mapping studies in MEN1 tumours using these 17 polymorphic markers in order to define the smallest region of loss within tumours. In addition a physical map of 11q13 is also being established using pulsed field gel electrophoresis (PFGE). Further studies are also being undertaken by using a linking library from chromosome 11. Hypoparathyroidism Hypoparathyroidism is an endocrine disorder in which hypocalcaemia and hyperphosphataemia are the result of a deficiency in parathyroid hormone (PTH) secretion. Idiopathic hypoparathyroidism has been reported to occur as an X-linked recessive disorder in two multi-generation kindreds in Missouri, USA. Affected individuals, who are males, suffer from infantile onset of epilepsy and hypocalcaemia, which appears to be due to an isolated congenital defect of parathyroid gland development; females are not affected and are normo-calcaemic. We have established linkage between X-linked hypoparathyroidism and the DXS98 (4D.8) locus (peak LOD score = 3.82, q = 0.05), and have mapped this disease locus to Xq26-q27. Multilocus analysis indicated that the disease locus is proximal to DXS98 but distal to the F9 (factor IX) locus. These results open the way for elucidating the genetic component involved in the embryological development of the parathyroid glands. We are pursuing studies to define precise genetic and physical maps around the X-linked hypoparathyroid locus. In addition, we have identified two families in which parathyroidism is inherited as an autosomal recessive disorder and one family in which there is an autosomal dominant inheritance. Investigations are underway to identify the mutations causing these autosomal forms of hypoparathyroidism. X-linked hypophosphataemic rickets (HYP) Hypophosphataemic (vitamin D resistant) rickets is the commonest form of metabolic rickets and an X-linked dominant inheritance has been established. Affected individuals have a renal tubular defect in phosphate transport and bone deformities. We have previously performed linkage studies and have mapped HYP to Xp22.31-p21.3 with the locus order Xpter-DXS43-HYP-DXS41-Xcen. More recently the linkage relationships of the cloned sequences DXS197 and DXS207 in relation to HYP have also been defined. Studies in man have been limited by the number of families available and the lack of highly polymorphic markers in this region. In order to overcome this we have pursued investigations using the murine homologous model hypophosphataemia (hyp). An interspecific back cross between Mus.spretus (wild type) and Mus.domesticus which is segregating for hyp and ta has been established in collaboration with Dr. S. Rastan (Section of Comparative Biology, Clinical Research Centre). We are investigating this interspecific back cross using murine DNA probes derived from CpG rich island libraries, which have been constructed by Dr. N. Brockdorff and Dr. S. Rastan (CRC, Harrow, Middlesex). Our aim is to define genetic and physical maps around the murine hyp locus and to identify candidate gene sequences. The characterisation of the murine hyp locus will enable characterisation of the HYP locus in man. We are also pursuing studies of the HYP locus in man by using a linking library from Xp. Chromosome 11 and Xp linking libraries Two genomic libraries comprising of clones containing CpG rich islands have been successfully constructed using the rodent-human hybrid cell line 1W1LA4.9, which contains chromosome 11 and Xp. CpG rich islands are found at the 5' (upstream) region of vertebrate genes and the use of clones containing such regions enables the identification of potential candidate genes. The genomic libraries were constructed using the rare-cutters Not I and Eag I and the regional localisation of these Not I and Eag I clones is being established by using a panel of somatic-cell hybrids containing fragments of human chromosome 11 or Xp. These Not I and Eag I linking clones will facilitate our genetic and physical mapping studies of MEN1 and HYP. In addition, these linking libraries of chromosome 11 and Xp will prove a valuable resource to other investigators who are pursuing disease loci on chromosome 11 and Xp. These studies of multiple endocrine neoplasia type 1 (MEN1), hypoparathyroidism and hypophosphataemic rickets (HYP) represent an integrated programme of basic science research applied to important mineral and endocrine disorders. Thus, in the investigation of MEN1 we are defining the basis for endocrine tumour development while in the study of X-linked hypoparathyroidism we are identifying the genetic component regulating the embryological development of the parathyroids, and in our investigations of HYP we aim to characterise a membrane transport protein for phosphate. These studies will further elucidate the physiological roles of these genes and their encoded proteins. Clinical Genetics (Dysmorphology) Research Group (Robin Winter) There are two main aspects of the research of the dysmorphology research group. The first is the use of computers for the diagnosis and classification of rare genetic conditions by creating and maintaining databases and appropriate computer software. The second is the genetic mapping of major genes predisposing to isolated malformations and malformation syndromes. The London Dysmorphology Database (LDDB) is a computer data-base of about 2,000 non-chromosomal, multiple congenital anomaly syndromes that can be used both as an aid to diagnosis for the clinician and as a reference source. It is available commercially through Oxford University Press. This is a joint project with Dr. Michael Baraitser (Institute of Child Health). A database of mouse malformation syndromes that can be searched by combination of physical abnormalities has also been prepared. Contributions to the human gene map include the mapping of Greig Cephalopolysyndactyly (GCPS) to 7p13 (in collaboration with Bob Williamson, London), the hypothesis that GCPS might be homologous to the mouse Xt - Extra toes gene, and mapping of complicated X-linked spastic paraplegia and mental retardation (MASA syndrome) to Xq28 (in collaboration with Kay Davies, Oxford). Current mapping work focuses on autosomal dominant craniosynostosis syndromes ad major genes for cleft lip and palate. Human Genome Mapping Project (Edward Tuddenham, Haemostasis Research Group, Clinical Research Centre) Activities relevant to Human Genome Mapping and to Mouse Genome Mapping 1. Human Genome In the course of improving methods for linkage analysis in haemophilia A we have identified a series of tandem repeat segments within the introns of the factor VIII gene. One of these has been characterised and proved to by highly variable and extremely useful in linkage analysis for kindreds segregating haemophilia A. We are also sequencing the exon flanking sequences in order to construct primers for rapid screening by means of PCR/chemical cleavage mismatch for mutations in haemophilia A. In a parallel project we are studying mutations in the factor VII gene of patients with factor VII deficiency. In the course of these studies we have identified a VNTR within the gene located therefore in the 13q34 region which may be useful for other mapping studies. Hereditary Haemorrhagic Telangiectasia is an autosomal dominant condition with as yet no established linkage. In collaboration with Dr. Michael Hughes at RPMS, we are preparing to collect samples from several large kindreds and to begin screening for linkage to highly informative markers throughout the genome. There are a few candidate genes that will be screened initially for linkage. 2. Projects relevant to mouse genome project In order to derive mouse models of haemophilia we have cloned the mouse factor IX gene in a series of overlapping cosmids. We have also partly (possibly completely) cloned the mouse factor VIII locus in lambda phage obtained from a library specifically constructed for the purpose. We also have YAC clones that hybridise to a mouse specific factor VIII probe and which could contain the entire mouse factor VIII locus. General comment An overall objective of the group is to advance knowledge of the structure and function of the coagulation factor proteins using variant proteins occurring spontaneously in haemophilia or thrombophilia as a tool in molecular analysis. We are also interested in the regulation of coagulation factor genes, in particular, tissue factor and factor VIII. Our work on mouse clotting factor genes was initiated in order to construct by means of homologous recombination mouse models of haemophilia. This interest would extend to cloning other mouse coagulation factor genes in order to make models of human thrombophilia. We are sharing information and will share samples for the HHT mapping project with Dr. John Burns group in the Division of Human Genetics, University of Newcastle upon Tyne. Molecular Genetics of the Mouse X-chromosome (Drs. Rastan, Brockdorff and Kay - Section of Comparative Biology, CRC) Our research on the molecular genetics of the mouse X chromosome is directed at (1) understanding the mechanism of X-chromosome inactivation, (2) the identification of genes associated with mouse X-linked mutations and, in many cases, with X-linked genetic disease in man and (3) the generation of new mouse models of human X-linked disease. To this end we have produced CpG-rich island linking libraries (NotI and EagI linking libraries) from the mouse X chromosome and isolated over 250 independent X-chromosome specific linking clones. 81 linking clones have been sublocalized to four regions of the mouse X-chromosome, using a panel of translocation carrying somatic cell hybrids which divide the X-chromosome into four regions. We have concentrated our efforts on the central region of the mouse X-chromosome, defined by the translocation breakpoints (T(X;16)16H and T(X;2)14R1, which contains not only the X-inactivation centre, but also, the tabby (Ta), mottled (Mo), broadheaded (Bhd) and sex-linked fidgit (Slf) loci. Seventeen NotI and EagI linking clones localized to this 11cM central region of the mouse X-chromosome have been mapped and ordered with respect to each other, existing DNA markers and genic loci, using interspecific backcross pedigree analysis. This region now contains on average one marker per 1,000Kb, which is well within the density needed to initiate physical mapping by Pulsed Field Gel Electrophoresis. In collaboration with Dr. Steve Brown's group at St. Mary's Hospital Medical School, we have initiated physical mapping of this region, with the aim of eventually producing a contiguous physical map. One linking clone in the central region, DXCrc171, detects a muscle-specific transcript, and a number of cDNAs have been isolated from a muscle-specific cDNA library. As EM171 maps close to the Slf locus, it may be a candidate gene for this locus. Similarly, a further linking clone, DXCrc169, has been used to isolate a highly evolutionary conserved sequence which co-segregates with Ta in our interspecific backcross pedigree analysis. Ta is the mouse homologue of the human disease gene hypohidrotic ectodermal dysplasia (XHED). We are currently analysing this conserved sequence as a possible candidate gene for the Ta locus. Transplantation Biology Section, Clinical Research Centre Mapping and cloning genes encoding ligands selecting the T cell repertoire (Drs. E. Simpson, K. Tomonari, P.J. Dyson, D. Scott and D. Altmann) Recent work published from our own and other laboratories has shown that selection of the T cell repertoire in the thymus, and hence the potential for reactivity of peripheral T cells towards self and foreign molecules, is governed by self-ligands associated with self major histocompatibility complex (MHC, H-2 in mouse, HLA in man ) class I and class II molecules. The expression of many of these self-ligands is polymorphic amongst inbred mouse strains. We are using the newly developed method of chromosome mapping by polymorphic microsatellites in backcross mice phenotyped for T cell receptor (TCR) expression to map the genes encoding the selecting ligands. Chromosomal mapping is being followed by physical mapping using YACs when we have identified tight linkage (one example is currently being tested). Candidate genes will be assessed in transfectants screened for expression by T cell clones specific for the ligands. An alternative strategy for cloning genes encoding these and other ligands recognised by T cells (eg. autoantigens), by modifying the Seed shuttle vector system, is also being developed (MRC core funding with an associated Cancer Research Campaign grant). T cell repertoire selection is also affected by expression of MHC genes, which are highly polymorphic in mouse and man. Certain MHC alleles in man are associated with predisposition to autoimmune disease (Type I diabetes, MS, RA). We are making mice transgenic for expression of particular human MHC class II genes to model human autoimmune disease (MRC core funding associated with an Arthritis and Rheumatism Council grant). The Y chromosome has relatively few functional genes, among them is that encoding the male specific minor histocompatibility antigen, H-Y. Our previous work, in collaboration with Drs. Anne McLaren, David Page, Els Goulmy and Malcolm Ferguson-Smith, separated the H-Y gene both in mouse and man from the testis-determining gene and mapped Hya on the short arm of the mouse Y chromosome, linked to Tdy, and HYA on the long arm of the human Y, distant from TDF on the short arm and close to the pseudoautosomal region. We are continuing deletion mapping studies in both species to obtain a moire accurate position of Hya and HYA. Biochemical Genetics Research Group (Chris Danpure and Ed Purdue) Normal human alanine:glyoxylate aminotransferase (AGT) cDNA has been cloned and sequenced (in collaboration with Yoshikazu Takada, Scripps Clinic) and a complete genomic clone has been restriction mapped and sequenced, demonstrating the presence of 11 exons covering about 10 kb. In situ hybridization (in collaboration with Sue Povey, MRC Human Biochemical Genetics Unit) and PCR analysis of human/rodent hybrid cell lines have indicated a chromosomal localization of 2q36-37. Three point mutations linked with the peroxisome-to-mitochondrion AGT targeting defect, found in one third of all patients with the autosomal recessive disease primary hyperoxaluria type 1, have been identified. In vitro mutagenesis/transfection/in vitro translation-import studies are currently under way to determine the exact contribution of each mutation to the acquisition and loss of functional mitochondrial and peroxisomal targeting sequences respectively. The molecular evolutionary basis of the species-dependent targeting of AGT is currently being investigated by comparison of AGT gene sequences in different mammals in relation to their different intracellular localizations of AGT. Section of Molecular Rheumatology (Dr. Patricia Woo and colleagues) The molecular genetics of serum amyloid A The main interest of this group centres around the acute phase protein serum amyloid A. During an acute inflammatory response serum amyloid A levels can rise to over 1,000 fold within 24 hours of initiating the event. There is a gene family for SAA and four genetic loci have been mapped in a cluster within a Not 1 band of approximately 350kb on chromosome 11. Useful restriction polymorphic sites have been defined for gene mapping of related genes on this chromosome. SAA genes are regulated by the inflammatory cytokines Interleukin-1, Interleukin-6 and TNFa. So far our studies have been focused on the transcriptional regulation of these genes and transcription factors that mediate IL1 and IL6 responses are being characterised. Collaboration with J. Saklatvala (Strangeways Laboratory, Cambridge) to study the intracellular signalling pathway in more detail is in progress. Serum amyloid A protein also is the precursor protein for amyloid fibrils in the potentially fatal disease amyloidosis that complicates chronic inflammation like juvenile or rheumatoid arthritis. In the past it has been difficult to purify large quantities of pure proteins for structure and function studies. The cloning of these genes allow us to study this by using recombinant proteins produced by high expression vectors in a mammalian system. The pathogenesis of amyloidosis could also be studied using these recombinant proteins. The use of transgenic technology is planned to study the biological significance of these SAA proteins. HLA associations with disease One subgroup of juvenile chronic arthritis has been shown to have strong HLA associations of DR5, DR8 and DPw2 in the past. A collaborative study is in progress with the RPMS (A. So) on the HLA associations with juvenile arthritis. Sequences of DRb and DPb chains are being compared using DNA amplification by PCR and oligonucleotide hybridization techniques. ii) IMPERIAL CANCER RESEARCH FUND a) Director's Laboratory (Sir Walter Bodmer) New approaches to the prevention and treatment of colorectal cancer, overall the second most frequent cancer in Britain, will come from an improved understanding of the fundamental genetics and biology of normal and abnormal colorectal epithelium. The laboratory's effort is devoted to genetic and cell biological studies in this area. Following the mapping of the gene for adenomatous polyposis coli (APC) to chromosome 5q21, various approaches are being used to find the gene itself, in collaboration with the Molecular Analysis of Mammalian Mutation and Somatic Cell Genetics laboratories. Highly informative flanking markers are now available for genetic counselling and various approaches are being used to find new clones in the neighbourhood of the APC gene region. Now that site-directed integration of selectable genes near to the APC locus has been achieved, the derived clones can be used for functional assays of tumour suppression by the APC gene. Mutations in the p53 gene in colorectal carcinoma derived cell lines have now been detected using DNA sequencing and chemical mismatch cleavage analysis. These changes correlate with increased expression of the p53 protein as detected by antibody assays. Reagents are being produced to carry out a functional analysis of the DCC gene as well as for long range physical mapping of chromosome 18. Genetic studies are also being undertaken on non-polyposis inherited colorectal cancer syndromes. Using cDNA expression cloning in mammalian cells, a cDNA clone for the AUA1 antigen has been isolated and is being used for functional analysis of the AUA1 antigen, in particular in connection with binding to extracellular matrix components. The role of carcinoembryonic antigen (CEA) in helping to mediate the attachment of the colorectal carcinoma-derived cell line SW1222 to collagen I is being studied further by the isolation of additional CEA related clones for functional analysis, the insertion of CEA by transfection into non-expressing cell lines and by further studies on the effects of monoclonal antibodies on glandular differentiation of responsive colorectal carcinoma cell lines. In addition expression cloning is being used to characterise the nature of the extracellular receptor expressed by the cell line SW122. The frequency of ras oncogene mutations has been shown to be significantly lower in a series of African colorectal carcinomas than it is in caucasoid derived tumours, suggesting differences in the aetiology of the carcinomas in these populations. b) Laboratory of Human Molecular Genetics (Dr. Peter Goodfellow) The laboratory is interested in two main areas of research. First, the developmental genetics of mammals using sex determination as a model. Recent studies have included the cloning of the pseudoautosomal region boundary and of SRY, a new candidate for the Y chromosome gene responsible for inducing testis formation. The second area of interest is the development of new strategies for controlled fragmentation of mammalian chromosomes. c) Human Immunogenetics Laboratory (Dr. John Trowsdale) The Human Immunogenetics Laboratory is interested in: 1) The organisation and functions of genes in the HLA region on the short arm of human chromosome 6. 2) Chromosome 6 in relation to t complex genes and to cancer. 3) Human zinc finger gene families. The HLA Region. The HLA complex encompasses over 50 genes on a stretch of DNA of about 4mbp. This is over 1/1000th of the human genome, or about the size of the E. coli genome. The region is associated with a large number of diseases, mostly of the autoimmune type. Our main efforts have been to isolate the class II genes, a process which is not yet complete, and to study their functions by transfection and expression in various cell types. We have now cloned the whole of the class II region in YACs, in order to facilitate further gene hunting and eventual sequencing of the whole MHC. Recent work has uncovered several novel genes in the class II regions and we are investigating their potential role in antigen presentation as well as their association with diseases. Chromosome 6. We have prepared irradiation hybrids containing fragments of chromosome 6 in a hamster background as a mapping tool. We have mapped some of the human equivalents of mouse t complex genes, such as TCP-1 to the long arm of chromosome 6. In addition, ovarian tumour/normal matched DNA samples have been prepared to look for allele loss. There are reports of the involvement of 6q in ovarian and colon cancer as well as melanoma and other tumours. Zinc finger genes. Our interests in this area have evolved from some initial studies looking for transcription regulators. We have described some extremely large families of multi-finger genes in man and mouse and are now attempting to isolate the specific DNA sequences they bind to. d) Genome Analysis Laboratory (Dr. Hans Lehrach) A major part of our work is concerned with development and application of new approaches to genome analysis, including the development of libraries as high density molecular mapping techniques (cosmid reference libraries of different human chromosomes, D. Melanogaster and S. Pombe, YAC libraries from man and mouse), the development and application of efficient hybridisation-fingerprinting techniques for the construction of ordered libraries of these organisms, and the development of short oligonucleotide hybridisation into an efficient sequence-fingerprinting and sequencing technique, applied e.g. to the characterisation of cDNA clone libraries. This work is complemented by the analysis of specific human (Huntington's disease, fragile X) and mouse genes (developmental mutations in the t complex, disorganised, steel), with a major emphasis on the use of YAC clones in transgenics to test for complementation of the relevant mutations in mouse, or to create appropriate animal models for human diseases. e) Human Cytogenetics Laboratory (Dr. Denise Sheer) We are interested in the analysis of consistent chromosome aberrations in human tumours. In the past few years, we have focussed mainly on childhood solid tumours and are now attempting to clone and identify the genes located at the translocation breakpoints in the t(11;22)(q24;q12) in Ewing's sarcomas and peripheral neuroepitheliomas. Several strategies are being used to this end, including the construction of NotI linking libraries, the isolation of YACs, and Alu-PCR cloning. Relevant probes are being mapped using a panel of interspecific somatic cell hybrids containing various fragments of chromosomes 11 and 22, and also using pulsed field electrophoresis. Our other major interest is the development of in situ hybridisation techniques for high resolution gene mapping and ordering. The simplest method involves the labelling of probes with biotin, hybridising the probes to chromosomes, and detecting them with avidin conjugated to fluorescein. The simultaneous use of two labels, such as biotin and digoxygenin, detected with different fluorochromes enables two or more probes to be ordered. We are also setting up this technique for the identification of specific chromosome rearrangements in solid tumours as a diagnostic acid. As it is often difficult to obtain good chromosome preparations from these tumours, the presence of particular translocations, for example, can be determined in interphase cells after hybridisation with probes mapping on either side of the translocation breakpoints. f) Molecular Analysis of Mammalian Mutation Laboratory (Dr. A-M. Frischauf) We are searching for several genes involved in diseases. One project concerns the identification of the gene for polycystic kidney disease. The region between flanking genetic markers has been completely cloned (in collaboration with S. Reeders, Yale) and we are applying various procedures that are generally used to search for genes in cloned genomic DNA. In particular we would like to concentrate on the comparison between cloned human and mouse DNAs from a relatively small homologous region. It may be necessary to screen the smallest possible region in great detail since there appears to be a large number of genes and high resolution long range restriction mapping has given no indication of deletions or rearrangements in the region. In collaboration with E. Solomon and W.F. Bodmer we are isolating new markers from the region of the APC gene and expanding the region around the markers by screening A. Monaco's YAC library. The markers are being used in the construction of a long range restriction map that will define the breakpoints in some patients with cytologically visible deletions. Conserved sequences are used in the search for the gene. iii) CHARING CROSS HOSPITAL MEDICAL SCHOOL (Keith Johnson) We are a group of eight engaged on mapping loci on human chromosome 19. We collaborate with the group of Steve Brown at St. Mary's on the comparative mapping of mouse chr 7 and human chr 19q. Our major interest is the myotonic dystrophy locus, for which we have generated detailed genetic and physical mapping data. As a result of this work we have extensive collections of probes for chromosome 19 as well as grids of cosmid clones for the entire chromosome and a subset specific to 19q13.2-13.3. Additionally we have interests in the malignant hyperthermia locus at 19q13.1-13.2 and we are actively mapping around the c-MEL locus on 19p13.1. We have constructed several PFGE maps of these different regions, comprising a total of 4-5Mb or about 10% of the chromosome length. We are currently characterising YAC clones of the myotonic and MEL regions looking for new genes within them. To date we have identified three new gene families from these resources and we are currently characterising these. iv) ST. BARTHOLOMEW's HOSPITAL We are currently studying the candidate genes underlying the inherited basis of non-insulin-dependent diabetes and premature coronary atherosclerosis. The project involves identifying possible loci using primarily a population genetics approach and then amplifying promoter sequences and critical exons for DNA sequencing, to compare cases against controls. The major genes that we are studying for non-insulin-dependent-diabetes are the insulin receptor on chromosome 19 P13; glucose transporter 1 on chromosome 1 P35, glucose transporter II, chromosome 3P26; and glucose transporter IV on chromosome 17 P11. With regard to the candidate genes for premature atherosclerosis, we are currently studying the apo-AI/CIII/AIV gene cluster on chromosome 11 and the lipoprotein lipase gene on chromosome 8P22 as well as the hepatic lipase gene. Possible etiological mutations will hopefully be identified, using this approach. v) ST. MARY'S HOSPITAL MEDICAL SCHOOL a) Mouse Molecular Genetics Group (Dr. Steve Brown) Mouse X chromosome A major project is underway, funded by the MRC and in collaboration with Drs. S. Rastan and N. Brockdorff at the Clinical Research Centre, to map and characterise the X-inactivation centre. A large number of microclones, linking clones and other genic probes have been genetically ordered in the region of the X-inactivation centre. Several clusters of probes have been physically-linked with the ultimate aim of constructing a physical map of the X-inactivation region with a YAC contig which will provide access to the underlying sequences responsible for the initiation of X-inactivation (Jacquie Keer and Renata Hamvas). We are also investigating the long-range structure of a repeat sequence island on the mouse X chromosome. The island consists of 50 copies of long complex repeat unit localised to the A3 dark-band of the mouse X chromosome. The repeat sequence island possesses two features that have been suggested as diagnostic features of mammalian Giemsa-positive bands. First, the repeat sequence island encompasses a 1-megabase region devoid of CpG islands; second, it features a high concentration of L1 long interspersed repeat sequences. We are presently recovering YACs from the island in both lab mice and wild mice to investigate further the long-range organisation and evolution of this chromosomal domain (Jamil Nasir and Patrick Mileham). Mouse chromosome 7 We have undertaken the comparative mapping of the proximal region of mouse chromosome 7 and established a conserved linkage group to human chromosome 19q - the location of the myotonic dystrophy (DM) locus. The comparative mapping has identified a small genetic region (1cM) on mouse chromosome 7 that is likely to contain the mouse homologue to the DM gene. Supported by the MRC, at present work on this project is concentrating on the establishment of a YAC contig covering the region of the mouse DM gene. In order to assist this work and to supplement the available mouse YAC libraries, we are presently constructing our own mouse partial RI YAC library (Francois Chartier and Julian Cavanna). In addition to work on the proximal region of mouse chromosome 7, we also have underway a mapping project, funded by the MRC, to isolate and characterise the mouse shaker-1 locus, a deaf mutation (in collaboration with Dr. K. Steel, MRC Institute of Hearing Research, Nottingham). Extensive genetic analysis of this locus through large backcrosses has allowed us to identify a DNA marker within several hundred kilobases of the gene. A YAC clone to this marker is being sought (Kathryn Brown and Maxine Sutcliffe). Mouse chromosome 16 Utilising interspecific backcrosses a genetic map spanning the whole of mouse chromosome 16 has been constructed. New probes to mouse chromosome 16 are being generated using inter-repeat PCR. An oligo from the 3' end of the mouse L1 repeat element has been used to specifically amplify mouse sequences from Chinese hamster-mouse hybrids containing only mouse chromosome 16. A number of the PCR products have now been mapped on mouse chromosome 16 in particular in the region syntenic with human chromosome 21 (Nick Irving). b) N.W. Thames Regional Health Authority DNA Laboratory (Carolyn Williams) The main aspect of our work is cystic fibrosis carrier detection and prenatal diagnosis. We are developing multiplex systems for the detection of the more rare mutations for CF on the basis of allele specific primers. There has been a pilot study for the preconception detection of CF carriers in the community running now for three months. Finally, we are currently establishing the reliability of PCR for the detection of single locus sequences within a single cell with a view to investigating allele segregation distortion. c) Alzheimer's disease and mapping chromosome 21 (Alison Goate and John Hardy) Alzheimer's disease is a very common neurodegenerative disorder affecting over half a million people in this country alone. At least in some cases the disease appears to be familial. Several large pedigrees have been described in which the disease onset is below age 65 yrs and appears to show an autosomal dominant mode of inheritance. We and others have reported linkage between Alzheimer's disease and DNA markers on the long arm of chromosome 21 in several pedigrees with the early onset form of the disease. The markers most closely linked to the disease gene are in the proximal region of the long arm (D21S13, D21S16, D21S1/S11) and not in the "obligate Down's region". Recent work in collaboration with Dr. Peter St. George-Hyslop has demonstrated that Alzheimer's disease is genetically heterogeneous and that late onset familial cases did not show linkage to chromosome 21 markers. We have used pulse-field gel electrophoresis to make a physical map of the proximal region of the long arm of chromosome 21. We are currently trying to isolate markers on the short arm of chromosome 21 to try to determine flanking markers for the AD gene and to extend our physical map of the chromosome onto the short arm. We are using several methods to isolate new polymorphic markers including screening clones for dinucleotide repeat sequences and Alu PCR in rodent/human hybrids to isolate new probes mapping to specific regions of the chromosome. d) Hereditary ataxia (Dr. Sue Chamberlain) The research group at St. Mary's has been established for the past five years working primarily on Friedrich's ataxia, a recessively inherited neurodegenerative disorder affecting the sensory nervous system with onset in childhood. In addition to confinement to a wheelchair, cardiomyopathy is also a primary feature of the disorder. Understanding the molecular basis of this disease will therefore provide insight into both the cardio- and neuropathologies, the mechanism of neuronal degeneration in general and should result in better management and eventually, therapy. Progress to date includes the assignment of the disease locus to chromosome 9q13-21.1 and the further definition of its precise location to a physical interval no greater than 1Mb. The cerebellar ataxias are clinically a poorly defined group of related disorders. In the majority of cases, the disease occurs sporadically or may have a familial element. We have recently initiated a project to investigate the molecular basis of one type of cerebellar ataxia, dominantly inherited olivo-ponto-cerebellar atrophy (OPCA) in a large Cuban founder population. With more than 1000 affected individuals homogeneous for a single mutation available for analysis it should be possible to precisely map the disease locus and approach the isolation of the defective gene itself. The clinical phenotype in these patients is indistinguishable from that described in families where the disease locus (SCA1) has been mapped to chromosome 6p. Interestingly, the Cuban disease locus has been excluded from this region providing conclusive evidence of genetic heterogeneity. A genome search is currently underway. e) Chromosome 21q22 (Drs. Peter Scambler and Elizabeth Fisher) A Down's syndrome 'obligate' or 'critical' region has been proposed to map to 21q22. We are creating embryo carcinoma cell hybrids containing 21q22 sequences using chromosome mediated gene transfer. Hybrids are currently being characterised with respect to human DNA content and potential for differentiation. Selected cell lines will be used to clone human expressed sequences from 21q22 which are expressed in particular embryonal cell types. Clones obtained will be inserted into the physical and genetic maps of the region. f) Chromosome 22q11 (Dr. Peter Scambler) 22q11 is a remarkable region of the genome in that it is the site of numerous nonrandom constitutional chromosomal rearrangements; the supernumary der(22)t(11;22) (q23;q11) is the most common non-Robertsonian constitutional rearrangements in humans. 22q11 aberrations are seen in DiGeorge syndrome (DGS) and cateye syndrome (CES); acquired rearrangements have been reported in seven different tumours, the best known being the Philadelphia chromosome. In addition, the region harbours sequences which appear to have been duplicated during evolution, but which are separated by at least 1Mb (eg. bcr-like and gamma-glutamyl transferase-like sequences). We have begun the physical mapping of 22q11 using naturally occurring deletions and translocations seen in DGS patients, pulse-field gel electrophoresis and YAC-walking. g) Mapping interests (Dr. Jane Hewitt) The human homeobox-containing gene HOX7 (the human homologue of the Drosophila msh gene) has been localised to chromosome 4p16.1. This maps the gene close to a human mid-line fusion syndrome, Wolf-Hirschorn Syndrome. Unlike most other vertebrate homeobox genes, HOX7 is not part of a tightly-linked Hos gene cluster, although it does appear to be part of a separate homeobox gene family. I am constructing a long-range physical map of the HOX7 locus and investigating the other members of the HOX7 family. vi) INSTITUTE OF CHILD HEALTH (Dr. Sue Malcolm) The Mothercare Department of Paediatric Genetics at the Institute of Child Health mainly concentrates on gene mapping projects with future clinical significance and unusual genetic inheritance. X-chromosome mapping studies and moves towards cloning the disease gene are being carried out on X-linked immunodeficiencies (Dr. Christine Kinnon) and X-linked deafness (Marcus Pembrey). Linkage studies on Hereditary motor and sensory neuropathy type I or Charcot Marie Tooth disease (Sue Malcolm with Anita Harding of the Institute of Neurology) are part of the MDAs international consortium. The study of Angelman syndrome (Marcus Pembrey and Sue Malcolm) has led to an appreciation of parental effects or genomic imprinting through the finding of only maternally derived deletions and uniparental paternal disomy. The genetic contribution towards clefting is being studied with Robin Winter (CRC) and there is an emphasis on the speedy transfer of research findings into clinical practice. vii) MOUNT VERNON HOSPITAL (Dr. Janet Arrand) a) Dr. Janet Arrand (plus 1 research officer and one student, supported by the CRC). Cloning and characterising the hamster and human genes which complement the human genetic DNA repair defect in xeroderma pigmentosum (XP)D. Identifying the mutations in XPD and the related genetic skin disorder, Trichothiodystrophy. Physical mapping of the chromosomal region which contains these genes. Isolation of XP proteins using antisera raised against peptides expressed from the cloned human XPD gene sequences. The development of predictive assays for radio- and UV-sensitivity using cloned DNA repair genes. b) Dr. Horst Lohrer (plus one research officer, supported by the CRC). Correction of the Ataxia telangiectasia (AT) defect by fusion of AT cells with hamster cells. Attempts to clone the correcting hamster sequence. Damage-induced proteins and their role in mammalian DNA repair. c) Drs. Janet Arrand and Mike Joiner (plus 3 staff and support requested from the UKCCCR). Assessment and correlation of cell killing, carcinogenesis and mutation (at loci on the X-chromosome) in human cells using low-dose ionising radiation. viii) THE GALTON LABORATORY The Galton Laboratory has a long history of human gene mapping. The first example of linkage between two human autosomal markers (nail patella syndrome and the ABO blood group) was discovered here. Interestingly, this linkage group was later assigned to 9q34, a region which has recently again become a focus of attention in the laboratory with the discovery of a linkage between tuberous sclerosis and ABO. Current research includes: Physical mapping studies on chromosome 1p (B. Carritt) Using somatic cell hybrids, pulsed field gel electrophoresis and cosmid contigs we are analysing that part of 1p which contains the Rhesus locus. We aim to correlate gene structure and genome organisation with serological haplotype at this locus. The use of denaturing gradient gel electrophoresis (DGGE) for human gene mapping (D. Hopkinson and P. Johnson) We have been evaluating this technique using known mutations at the human _1-antitrypsin locus and, using various combinations of 5' or 3' attached GC clamps, have been able to display all the common polymorphisms. We are now beginning to study uncharted DNA sequences in collaboration with many of the projects below. The mucin gene family (D. Swallow) The extent, nature, stability and significance of the extensive polymorphism at the gene loci which code for mucins (so far MUC1 to MUC3) are being studied. We have isolated cDNA and genomic clones for MUC1 and we have mapped each of these genes to different chromosomes (MUC1 1q21; MUC2 11p15.5; MUC3 7q) using a combination of somatic cell hybrid, in situ hybridization and linkage analysis. Biochemical and genetical analysis of the hydrolases of the small intestine (D. Swallow and Y. Edwards) We have isolated cDNA clones for lactase and cDNA and genomic clones for sucrase-isomaltase (SI). We have mapped SI to chromosome 3q25-26 and we are searching for polymorphism at the SI and lactase loci for the purpose of family analysis. Assignments of new genes to chromosomal regions by somatic cell genetics (S. Povey) There is a continual program of assignment of newly cloned genes to chromosomal regions using somatic cell genetic techniques. In the past year about 30 genes and polymorphic DNA fragments have been assigned to chromosomes or to chromosomal subregions. Family studies on Tuberous sclerosis. (S. Povey, M-W. Burley and J. Attwood) This dominant autosomal genetic disease is unusual in showing a very high mutation rate and a wide variation in the degree to which it is expressed ranging from the almost symptomless to severe affliction. The genetics is complicated because two (possibly three) mutant loci with identical effects are present in the population. The combined effects of locus heterogeneity and difficulty of diagnosis coupled with a high mutation rate make genetic analysis an interesting problem! It is being tackled in collaboration with many laboratories both in the UK and in the USA using shared probes and families. Conventional probes are being used but more highly polymorphic markers such as poly CA repeats are being developed. Irradiation fragment hybrids from chromosome 9q (J. Wolfe and S. Povey) A panel of hybrids has been constructed which contain small fragments of 9q in a hamster background. Suitable hybrids are being sought from which 9q34 probes may be isolated. Probes from one such hybrid are already being screened for (CA)n and other highly polymorphic microsatellites. Polymorphic probes will be used for TSC family studies. The panel of hybrids and probes derived from them are available for other mapping studies on chromosome 9q. Irradiation fragment hybrids from chromosome 11 (F. Benham and S. Povey) Hybrid cell lines which retain unselected and selected fragments of chromosome 11 are being constructed using high dose irradiation-fusion gene transfer. Both hybrid series will be characterized according to fragment size, number and origin by marker analysis and in situ hybridization. The unselected hybrids will provide resources for 1) generating region specific probes from throughout chromosome 11 and 2) ordering and mapping known probes using a statistical approach. We plan to concentrate on developing markers for the 11q22-23 region with a view to improving the genetical and physical maps of this region, to which the second tuberous sclerosis locus, TSC2, has been localized. Both this study and the previous one make use of cytogenetic and in situ fluorescence microscopy in collaboration with J. Delhanty. Generation of probes from Xp22 (F. Benham) Using a previously constructed panel of irradiation fragment hybrids, probes are being isolated from the Xp22 region by a variety of methods including alu primed PCR and construction of genomic libraries. These are being used to improve the genetic and physical maps of the region. Computer methods in gene mapping (J. Attwood) We are interested in making genetic maps of entire human chromosomes, as part of the CEPH collaboration, and in the localisation and precise mapping of disease and other genes of interest. In collaboration with Prof. N.E. Morton (CRC Genetic Epidemiology Unit, Southampton) we are investigating the relative strengths of the currently available mapping packages, in particular their ability to cope with errors in the data. One such method which we are exploring with S. Povey uses a pairwise analysis of the mapping data. This has a number of advantages when compared with the multipoint method. There is no constraint on the number of loci, it uses lod scores (there is no need for the primary data), it allows the pooling of data from many sources and it allows for interference. In collaboration with S. Bryant (ICRF, Clare Hall) we are also developing ideas and software to enable family data to be more easily exchanged between laboratories and be used as input for any of the available analysis packages, converting reliably and intelligently between otherwise incompatible data formats. An IBM PC-based family database management program, incorporating many of these ideas, is currently under development and will eventually be ported to run on Unix systems. PCR markers for all the human chromosome arms (C. Abbott) Pairs of primers have been developed (mostly from intronic or 3' noncoding sequences) which are human specific and which enable the rapid identification of the human chromosome arm content of rodent/human somatic cell hybrids. This work is in press in Genomics. Molecular genetic analysis of mouse chromosome 2 (C. Abbott) This work has two primary aims. First, to improve the genetic map of this chromosome and second, to isolate genes involved in neurological development e.g. wasted (wst), anorexia (anx) and lethargic (lh). Proximal mouse chromosome 2 (which shows genetic homology to human chromosome region 9q34) is being mapped using an interspecies backcross with Mus spretus. This work is being carried out in collaboration with Dr. J. Peters (MRC Radiobiology Unit, Harwell). In addition we are constructing a series of mouse/hamster somatic cell hybrids containing various chromosome 2 translocations. These are being characterized by PCR using species specific primers derived from chromosome 2 genes. A genomic library specific for the chromosome is being constructed (from a hybrid cell line which contains only mouse chromosome 2 in a hamster background) and it will be screened for expressed sequences using brain cDNA depleted of repeated sequences by the method of Hochgeschwender et al. (PNAS 86 8482). A contig map of the human Y chromosome (J. Wolfe) We have isolated 2,000 cosmid clones derived from the human component of a mouse-human somatic cell hybrid which contains only the human Y. These will shortly be joined by more clones derived from an independent Y only hybrid. The clones are being fingerprinted by a variant of the method of Coulson et al. (PNAS 83 7821). More than 500 clones have been fingerprinted and 250 of the fingerprints have been digitized for computer analysis. This step is now proceeding at the rate of about 200 clones per week. When all 2,000 clones have been fingerprinted, approximately 90% of the euchromatic portion of the chromosome will have been cloned and approximately 60% of it will be in contigs. We propose to continue fingerprinting until the rewards (clones which extend or link contigs) cease to outweigh the effort involved. We estimate that this will occur in about another 2,000 clones. The library is available for screening as a gridded array both of colonies and of dot blots. We would welcome anyone else's Y derived cosmids for fingerprinting. ix) UNIVERSITY COLLEGE & MIDDLESEX SCHOOL OF MEDICINE a) Cloning of human genetic disorders by use of short, conserved oligonucleotides (Dr. Georg Melmer, Department of Psychiatry) The mapping and eventual sequencing of the human genome depends upon the power and efficiency of new techniques to be developed. We are developing such techniques aiming to make long range mapping, identification of coding sequences, and their searching simpler and considerably faster. We are using short oligonucleotides (8-15 nucleotides) corresponding to conserved sequences such as restriction enzyme sites, transcription factor binding sites or splice sites. Several sets of oligonucleotides have been used so far. These short oligonucleotides are designed to isolate sequences corresponding to: 1) GC-rich sequences localised close to or within genes 2) Sequences associated with the binding of transcription factors 3) Sequences surrounding splice sites to detect expected exon-intron boundaries. This work is focused on chromosome 7 using a chromosome specific cosmid library which is being screened with the three sets of oligonucleotides described above. This library has already been screened with short tandem repeat sequences for (CA) or (CT)n repeats and over 100 cosmids give positive hybridisation. These will be of value in the generation of a genetic linkage map of highly informative markers. All cosmids have already been looked at with the splice site oligos and the transcription factor binding site primers. It is expected to generate three different "maps" side by side: the genetic map, the physical map, and the distribution of coding sequences and at the end of the sequence itself. b) Department of Medicine (Professor J.L.H. O'Riordan) The major aim of this group is to study the genes controlling mineral metabolism, ie. the maintenance of calcium and phosphorous homeostasis. The control of the expression of the gene for parathyroid hormone (11pter-p15.4) has been shown to be abnormal in parathyroid tumours. The gene causing X-linked recessive hypoparathyroidism has been localised to Xq26-q27. Mutations in the gene for the receptor for Vitamin D (chromosome 12) have been shown to cause rickets due to end organ resistance. Studies of the gene causing X-linked hypophosphataemic rickets are aimed at increasing the understanding of phosphate handling, particularly in the kidney. The gene has been localised to Xp22.31-p21.3 and flanking markers (DXS41 and DXS43) identified. Further work is in progress to get closer to and to clone the gene: that requires new markers in this region, and identification of deletions in this part of the X-chromosome. x) Royal Postgraduate Medical School, Hammersmith Hospital (Lucio Luzzatto) (1) Molecular genetics of glucose 6-phosphate dehydrogenase (L. Luzzatto, P. Mason et al.). We are investigating structural point mutations, promoter structure and function, and the function of introns. We are also comparing the structure of human, mouse and opussum G6PD, and we are in the process of obtaining the malaria parasite G6PD gene. (2) Studies on the BCR-ABL chimeric gene. (J. Goldman, J. Vaz de Melo et al.). We are analyzing breakpoints in CML and ALL and investigating the possibility of ABL mutations not involving PCR in "atypical" CML. (3) The t(8;21) translocation which is highly associated with M2 AML. (F. Calabi). We are investigating by various techniques, including microdissection of metaphase chromosomes and the production of region specific libraries, the breakpoint of this translocation. (4) Studies on collagen genes (P. Mason, N. Turner). We are investigating the gene encoding the antigen involved in the pathogenesis of the Goodpasture syndrome. xi) United Medical and Dental Schools of Guy's and St. Thomas's Hospitals Molecular Genetics Laboratory (David Bentley and Francesco Giannelli's Group) Identification of sequence variation for mapping, detailed locus analysis and identification of disease related genes (Green, P.M., Harris, I., Montandon, A.J., Naylor, J., Roberts, R. and Saad, S.). Our commitment to genome mapping and our interest in diseases of high mutational heterogeneity (e.g. haemophilia B or coagulation factor IX deficiency) has prompted us to develop methods for the rapid detection of DNA sequence variations. We have thus developed a mismatch detection method (amplification mismatch detection, or AMD) that can screen heteroduplexes of up to 1.5kb for any kind of mismatch and so detect and locate any type of sequence variation. This method has been used for the detection of DNA polymorphisms (e.g. in the dystrophin gene) and the characterisation of mutations in different genes (e.g. haemophilia A, haemophilia B, Tay-Sachs disease and Cystic fibrosis). Using AMD and direct sequencing of PCR products we have reduced the time required fully to characterise mutations of the factor IX gene (34kb, 8 exons) to 4 person working days. Carrier and prenatal diagnosis based on the direct detection of the gene defect have thus become feasible, increasing the proportion of families that can be helped by precise genetic counselling from 50-60% to 100%. Furthermore, the characterisation of large populations of patients and, hence, the full definition of the mutational profile of the factor IX gene, has become feasible. We have, therefore, conceived a strategy to optimise the genetic counselling of haemophilia B while maximising the practical and scientific advantages of diagnoses based on the direct detection of gene defects. This requires the characterisation of the defect in every UK haemophilia B family and the construction of a national database to store such information. This can then be used for generation after generation to provide the relatives of the index patients with carrier and prenatal diagnoses based on the detection of the gene defect at 1/10 of the cost and in a fraction of the time currently required. Up to now we have characterised more than 1/5 of the U.K. population (total approx. 1,000 patients) and thus identified more than 60 residues essential to the structure and function of factor IX. New technical advances, including the direct analysis of amplified "leaky" mRNA from peripheral blood lymphocytes, are now being developed to allow extension of the above strategy to diseases of high mutational heterogeneity irrespective of the complexity of the gene and the prevalence of the disease. For example, the entire dystrophin coding sequence has been amplified in ten overlapped nested PCRs in Duchenne and Becker muscular dystrophy patients and their relatives in order to detect the presence of deletions or insertion at the mRNA level. This study forms the basis for detection of point mutations by AMD analysis. These approaches should also be valuable to identify specific disease-related genes among series of candidate genes selected on the basis of mapping information. Molecular mapping of the X chromosome (Coffey, A., Cole, C., Collins, J., Dunham, I., Flomen, R., Green, E., Hassock, S., Holland, J. and Todd, C.) As a model system, yeast artificial chromosomes (YACs) spanning the dystrophin gene have been isolated and overlapped in contigs using a sequence-tagged site (STS) approach. individual STSs distributed throughout the gene have been used to screen the YAC libraries of Burke and Olson (in collaboration with E.D. Green, St. Louis) and Anand et al., by PCR. YACs have been characterised by screening with cDNA probes. A rapid fingerprinting method for overlapping YACs without prior knowledge of insert sequences has been developed using the DMD YACs. A panel of radiation fusion hybrids has been generated, which contains regions of the X chromosome around the HPRT locus. The hybrids have been characterised by hybridisation to single copy-probes. Alu PCR of the DNA from one hybrid has been used to generate STSs and hybridisation probes for isolation of YACs in Xq26. Optimisation of the Alu PCR conditions permits the generation of fragments at intervals of 50-1,000kb in this region of the X chromosome. A library of clones derived from a microdissected region of the X chromosome (Xq27.1-Xq28.1) is being used as a source of hybridisation probes; to construct STSs for isolation of YACs; and for characterisation of sub-microscopic deletions in patients suffering from Haemophilia and Hunter syndrome. Cosmid libraries from DNA of an individual with the karyotype 49, XXXXX have been constructed, and deposited in ordered arrays. An automated gridding procedure has been developed by construction of an inoculating tool and associated software (soon to be released) to fit the Biomek 1000 robotic workstation (Beckman). The cosmid clones have been verified by mapping overlapping clones spanning a 200kb region. Work is in progress to build larger contigs of overlapping clones and to identify landmarks within the map. Automated sequences and genomic clone fingerprinting using fluorescent labelling techniques is being evaluated using the Applied Biosystems AB1373 Automatic DNA Sequencer. Techniques are being developed to prepare samples using either dye-labelled primers or dye-labelled terminators for detection of overlaps by restriction fingerprinting (applied to YAC clones or cosmid clones),detection of polymorphisms and mutations in genes using amplification and mismatch detection (AMD) analysis. Methods to screen YAC libraries both by hybridisation and by PCR approaches have been optimised. The human YAC library of Burke and Olson has been transferred from St. Louis, and DNA from pooled clones has been made for PCR screening. Using the automated gridding facility developed for cosmids (see above), the entire library (60,000 clones) can be deposited in ordered arrays on 40 8x12cm filters for primary hybridisation screening. The library is now established both here and in Oxford (with Dr. K. Davies). The library and the screening technology is being transferred and will form part of the UK Human Genome Resource Centre at Northwick Park, under the direction of Dr. R. Sibson. Ann Harris's Group (Boye, E., Chalkley, G., Coleman, L., Flinter, F., Foulkes, A. and Vetrie, D.). Our two main research interests are in the fields of cystic fibrosis and Alport syndrome. Cystic fibrosis. The CF work can be divided into three main areas. The first and major one is the application of the cell systems that we have established for pancreatic duct and male genital duct, to further understanding of the role and mechanism of action of the CF gene product (CFTR). In particular we are interested in regulation of expression of CFTR and the effect of expression levels on cell phenotype. The second project is to analyse developmental expression of the CF gene in Man, in order to throw light on the pathology of the disease. The third project is to search for alternative mutations (other than F508) in the CF gene. Alport syndrome. Alport syndrome is an X-linked kidney disorder that is characterised by chronic renal failure, high-tone sensorineural deafness and specific eye defects in affected males. Carrier females show a wide range of clinical severity. The gene maps to Xq21-22, an area of the chromosome that has received comparatively little attention. Two projects are being undertaken. Firstly, we are constructing a long-range linkage map of this region of the X chromosome by pulse-field gel electrophoresis, using markers that are known to be closely linked to the Alport locus. YAC clones are also being isolated from this region. Secondly, it now seems likely that the a5 (IV) chain of basement membrane collagen that maps to Xq22 is in fact the Alport gene product. We have a large collection of DNAs from Alport syndrome families. This material is now being analysed to establish the nature of the mutations in the a5(IV) collagen chain that contributes to the disease. S.E. THAMES REGIONAL DNA LABORATORY Chris Mathew's Group (Abbs, S., Beards, F., Clarke, S., Dear, S., Differ, A.-M., Holding, C., Lee, R., Silver, A. and Yau, M.). We are using genetic linkage analysis to map the genes involved in several human genetic disorders. Fanconi anaemia (FA) is a rare autosomal recessive disorder associated with bone marrow failure and an increased susceptibility to leukaemia. Candidate DNA repair genes are being tested, and chromosomes not yet excluded for linkage to FA are being analysed systematically. We are also carrying out high resolution linkage analysis of chromosomal regions of particular interest by means of the CEPH collaboration. PCR markers at the 5' and 3' ends of the dystrophin gene have been analysed, showing a 12% recombination rate across the 2.3Mb of this gene (Abbs et al., Genomics 7, 602-606; 1990). Further markers are being tested at this locus, and multi-allelic PCR markers developed, in order to localize the intragenic crossovers more precisely. Nested PCR of sequences from single cells is being developed for pre-implantation diagnosis and high resolution linkage analysis. xii) Institute of Neurology (Professor Louis Lim & Dr. Christine Hall) The group interests are concerned with the characterization of genes either highly or specifically expressed in the human brain. These genes include those for carboxypeptidase E, a putative neuropeptide processing hormone and for n-chimaerin, a novel phorbol ester receptor (which is related to PKC) containing a BCR-like domain (BCR is the product of the breakpoint cluster region gene in chromosome 22). Both are single-copy genes of at least 75kb. Genomic organization is being studied with regard to regulatory sequences responsible for brain- and regional-specific transcription as well as to separate functional domains. Another interest is the characterization of brain-expressed genes on chromosome 21. The group collaborates with the Institute of Molecular and Cell Biology, Singapore. xiii) London School of Hygiene and Tropical Medicine (Dr. Neil Stoker) My interest is in the production of integrated genetic/physical maps of bacterial chromosomes, in particular of Mycobacterium leprae and M.tuberculosis, which cause leprosy and tuberculosis respectively. The main relevance of the human genome mapping project to me is therefore methodological. I am constructing ordered libraries using the fingerprinting approach devised by Alan Coulson and John Sulston at the LMB, Cambridge, doing the data entry and computer analysis using Peter Little's set up at Imperial College. Restriction mapping and gene mapping on assembled parts of the map are also underway. I hope that in the not-too-distant future this work will lead to the sequencing of one of these genomes (probably M.tuberculosis), which has a size of approximately 3Mb). xiv) Imperial College of Science Technology and Medicine (Dr. Peter Little) The short arm of human chromosome 11 is one of the most intensively studied regions of the human genome. Over 350 DNA markers and genes have been regionally localised, over 100 deletions have been identified and immortalised in hybrid cell lines and a large body of work has been aimed at understanding the involvement of this region in tumour formation and embryonic development. It is an attractive candidate for any systematic mapping study. For these general reasons, and also to provide a practical test-bed of a human genome mapping project on a single lab scale of operations, we have chosen to construct a cosmid clone map of human chromosome region 11p using technology that was originally developed by John Sulston and Alan Coulson at LMB Cambridge. We use mouse human hybrids containing 11p as source of the chromosomal region (generated by Porteous and van Heyningen at the MRC human genetics unit, Edinburgh) and isolate human cosmids, at random, by hybridisation of radiolabelled total human DNA to cosmid libraries. These DNA clones are cut with restriction enzymes to give a fragment "fingerprint" on an acrylamide gel, the autoradiograph of which is digitized and analysed by a sophisticated set of image analyses and data manipulation programs running on a VAX station 3100. Cosmids that overlap with each other are identified by having a similar or partially similar fingerprint. The project proceeds by generating increasingly large regions of DNA contained in overlapping cosmid sets, called "contigs". We currently have a database of 3700 cosmids and 500 contigs. This probably corresponds to 2.5 x 10^7 bp of DNA. We make extensive use of a robot work station for growing clones, making DNA and general sample handling, which we find reduces much of the inevitable tedium of reiterative and stereotyped manipulations. The 11p region corresponds to perhaps 40% of chromosome 11, which is itself about 2.4% of the human genome: this means we are mapping about 40% of 1.44 x 10^8 bp or about 6 x 10^7 bp. We expect to have to analyse about 10,000 cosmids in total. The equipment used to analyse and generate contig maps is available for general use. We would point out that this approach should be a serious consideration for anyone interested in generating ordered cosmid or phage libraries from an individual YAC clone(s). This sort of small project (less than 100 fingerprints) can be carried out within a few weeks of obtaining a library. We would stress that if groups are interested in this approach, they should approach us for advice before starting to collect data or clones. Our experience is that simple advice is always needed at the start and this saves much time later. A major thrust of the genome project has been to centre on specific or chromosomal regions, or on expressed genes. In a related project we have started to work on Zn finger protein encoding genes (ZnFP). These genes, remarkably, correspond to about 1% of the human genome and we have initiated a systematic study of clusters of potential ZnFPs in both human and mouse genomes, in collaboration with M. Mannens and J. Hoovers (Amsterdam). We have identified clusters of ZnFPs in several provocative positions on the short arm of chromosomes 3, 11, 19 and 20, and in similarly interesting regions of 19q, and the pericentric region of 21. ZnFPs have been implicated in controlling a number of developmentally complex processes in D. melanogaster, in tumorigenesis and identified as transcription factors involved directly in controlling gene expressions makes them attractive candidate genes and we are actively working to analyse the relationship of our ZnFPs with diseases and conditions known to map to the appropriate regions. Our work is generously supported by the MRC, by the Human Genome Mapping Project directed program of the MRC and by the Cancer Research Campaign. 8) THE EUROPEAN COLLABORATIVE INTERSPECIFIC BACKCROSS - A FACILITY FOR MAPPING THE MOUSE GENOME (Dr. Stephen Brown, Dept. of Biochemistry and Molecular Genetics, St. Mary's Hospital Medical School, London W2 1PG) As indicated in G-NOME NEWS (no. 4), a policy document outlining the role of Mouse Genome Mapping in the Human Genome Mapping Project has been received by the Directed Programme Committee and its recommendations broadly accepted. One of the proposals put forward by this report was to initiate a facility for the genetic mapping of the mouse genome. A detailed proposal was put to the Directed Programme Committee and funds are now available to put into operation. MOUSE GENOME MAPPING Copies of the Report of last April's meeting on the role of mouse genome mapping in the Human Genome Mapping Project are still available, free-of-charge: telephone Joanne Grewcock at the Resource Centre (081-869 3805) or send a fax (081-869 3807). The Report was accepted by the Directed Programme Committee as a basis for policy in this area. It thus provides useful guidance on what sort of grant applications are likely to find favour with the DPC. The aim of this facility will be to support the worldwide goal of a 1cM genetic map of the mouse genome. The mapping facility will make use of a large 1,000 animal interspecific backcross between inbred lab mice and the wild species Mus spretus. Use of interspecific backcrosses is now widespread taking advantage of the high evolutionary divergence separating the two parental strains and the ease with which restriction fragment length variants and other variants can be found. 500 animals will be derived from backcrossing to lab mice and 500 animals derived from backcrossing to spretus. It is necessary to analyse 500 backcross progeny to have a 99% chance of separating markers that are 1cM apart. This genetic facility will operate from two centres: 1. The Resource Centre and Comparative Biology Section, CRC, London 2. Institut Pasteur, Paris. Both centres are presently engaged in generating backcross progeny and both centres will participate in the mapping facility. Progress towards a mapping facility is seen as a two-stage phased process: Stage I: a) generation of 1,000 backcross progeny set b) isolation of DNAs; pooling of DNAs at the two centres c) initial mapping analysis of DNAs to establish anchor loci d) establishment of database structures Stage II: a) Full mapping facility: receipt of probes, STSs and provision of mapping information to users b) Fully operational mapping database and probe list. Stage I involves the analysis of the entire cross with at least 60 readily usable DNA markers (preferably STSs) to provide anchor loci across the genome. The choice of these loci has largely been determined by the work of the mouse chromosome committees at the recent International Mouse Gene Mapping Workshop (Annapolis, USA) that established a small set of at least five reference loci for each chromosome. Such loci have already been widely used in future mapping projects to allow the reference and anchoring of different maps created in different laboratories. Most of these reference loci are STSs. The initial genetic analysis identifies subpanels of mice with pools of recombination events on individual chromosomes. Most subpanels will be devoted to individual chromosome mapping; but subpanels can be created for rapid chromosomal assignment. The subpanel system is flexible and panel size can be increased to meet the needs of the mapper as ever more finer genetic intervals are analysed at a particular chromosomal region. The initial typing of the Backcross for Reference loci will depend not only on work at the two participating centres, but also a number of British and French groups who with substantial interests in Mouse Genome Mapping are prepared to supply probes and participate in the establishment of the initial global, anchored STS map. It is expected that Stage I will take at least one year to complete. Stage II involves the operation of a full mapping service; DNA from backcross progeny will not be generally available. Rather, probes will be received and analysed at the two centres and mapping information transmitted to the probe supplier. Stage II will also involve the implementation of on-line access to the database supporting the cross. A steering committee has been formed to oversee the operation of the facility and includes representatives from the two mapping centres and the Participating Groups. Progress to date The backcrosses at the Clinical Research Centre and the Institut Pasteur are well advanced with close to 300 backcross progeny in total so far recovered. At the Resource Centre, two staff have been appointed and have begun the preparation of DNAs from backcross progeny produced on site. Exchange of DNAs with the Institut Pasteur will begin shortly. At the beginning of 1991, the first analysis of anchor loci will begin. The Future We look forward to the completion of the anchored, global STS map. Following completion, we aim to issue necessary documentation to the genome mapping community outlining mechanisms of access to the mapping facility. In addition, the progress of this cross must take account of and interface with similar projects underway in the States. Discussion is already underway on the possibility of common database structures that would allow us to integrate mapping information worldwide. Further information may be obtained from: Steve Brown Dept. of Biochemistry and Molecular Genetics St. Mary's Hospital Medical School London W2 1PG 9) OLIGONUCLEOTIDE PRIMERS FOR PCR ANALYSIS OF MOUSE MICROSATELLITES (Dr. John Todd, Nuffield Dept. of Surgery, John Radcliffe Hospital, Headington, Oxford OX3 9DU) All these primer sequences and conditions of use were contributed by Dr. John Todd and colleagues and further information on their use may be obtained from him at Nuffield Dept. of Surgery, John Radcliffe Hospital, Headington, Oxford OX3 9DU; Tel.No: 0865-220145, FAX: 0865-68876). The HGMP Resource Centre is aiming to synthesise all of these oligonucleotides in the next few weeks and aliquots of these will be available to any registered users under the standard conditions. These include the reporting back of details of use of materials distributed from the Centre. Further details of the primer availability and custom oligonucleotide synthesis can be obtained from Dr. Gabrielle Fisher at the HGMP Resource Centre on tel.no. 081-869 3446. A number of these primer sequences are unpublished and reference should be made to the Newsletter and to John Todd for this privileged information. Please see Appendix II for Mouse Chromosome Specific Microsatellites table. 10) DIRECTED PROGRAMME AWARDED PROJECT GRANTS Dr. Furzana Bayri Medical Research Council 20 Park Crescent London W1N 4AL Project grants awarded by the HGMP Directed Programme Committee in July 1990: i) Dr. K. Davies - "X chromosome Workshop" ii) Dr. S.D.M. Brown - "A European collaborative interspecific backcross facility for mapping the mouse genome" iii) Drs. Y. Boyd, K.E. Davies and M.C. Hirst - "Comparative mapping of mouse and human X chromosome using microdissection clones" iv) Dr. J.A. Todd - "Characterization of variant DNA markers from the mouse genome" No awards were made at the November meeting of the HGMP Directed Programme Committee. For your information the dates for the next Directed Programme Committees and the subsequent deadlines for any project grant applications are as follows: Directed Programme Committee Deadline for Project Grant Applications 27th February 1991 29th January 1991 21st May 1991 22nd April 1991 Further guidance on the areas of work that are eligible for HGMP project grants The directed programme of research supports projects that are aimed either at making a direct contribution to genome mapping or at developing enabling techniques. Since the initial call for proposals was issued in April 1989 (GTA Note No. 244), 83 proposals have been considered by the Directed Programme Committee and 48 grants costing over #6.3m have been awarded. While the majority have been three year grants, some awards have been for pilot studies and for major equipment. The grants awarded by the Directed Programme Committee to date have brought about a selective expansion within the UK of genetics research relevant to the mapping of the human genome. In future, HGMP support will be more focused and in the first instance the highest priority will be given to the following areas: (i) Genome analysis - This includes projects that can be seen as representing a contribution to general genome mapping. Projects that have as their primary objective the isolation and characterization of a specific gene or gene cluster do not, therefore, qualify for HGMP funding. The HGMP may, however, occasionally support projects involving the systematic mapping of substantial segments of DNA, provided that there is a clear intention to contribute to genome mapping and not just to isolate one particular gene from within the segment in question. In addition to studies on the human genome itself, support will be given to equivalent studies of the mouse genome, since it is considered that the results obtained will facilitate the analysis of the human genetic complement. Support for work on the genomes of other species will depend on a strategic case being argued. (ii) Technical development - projects aimed at the development of new enabling technologies e.g. vectors, cloning hosts, reagents, computer software techniques and scientific equipment, especially when there is likely to be a significant pay-off in the short-term, for the benefit of the other parts of the Project. (iii) Evaluation of techniques and equipment - work that involves the application of newly-developed techniques and equipment within genome analysis projects, in order to assess whether they offer advantages over the existing (or other novel) methodologies. (iv) Studies of specific structures within the genome - projects that involve the study of particular structural arrangements or sequences within the genome, with a view to developing new methodologies that utilize these structures for genome analysis. An overall guide is that in order for a project to qualify for HGMP support there should be a reasonable likelihood that it will generate scientific findings, technical information or experimental resources that would be of value to the genome mapping community, as a whole, rather than just to those researchers working on a particular gene or gene cluster. 11) 1991 HGMP RESEARCH STUDENTSHIP AWARDS Department and No. of Awards Supervisor(s) Project Title Institution 1 Dr. R.D. Sutcliffe 1 Dr. K. Kaiser Genetics, Glasgow Reverse genetics of Drosophila 2 Professor J.H. Edwards 1 Dr. G.K. Brown Genetics Laboratory, Biochemistry, Oxford Patterns of X-inactivation and manifestation of X-linked diseases in human females in relation to genes in the region of Xp22.1 3 Professor A.B. Rickinson 1 Dr. A.M.R. Taylor Cancer Studies, Medical School, Birmingham Mapping and cloning the gene for ataxia telangiectasia 4 Professor H.J. Evans 1 Dr. R. Allshire MRC Human Genetics Unit Edinburgh The construction of artificial chromosomes in S.pombe for cloning large DNA fragments 5 Professor R.P. Ambler 1 Dr. D. Leach Institute of Cell and Molecular Biology, Edinburgh Illegitimate recombination in E.coli 6 Dr. K.B.M. Reid 1 Dr. R.D. Campbell MRC Immunochemistry Unit Oxford Cloning of genes in the human Major Histocompatability Complex class III region by use of novel techniques 7 Dr. J. Wyke 1 Dr. A. Balmain Beatson Institute for Cancer Research, Glasgow Identification of potential tumour suppressor genes by microsatellite deletion mapping in rodent and human tumours 8 Professor P.S. Harper 1 Dr. M. Upadhyaya Institute of Medical Genetics, Dr. M.J. Owen University of Wales College of Medicine Isolation of the gene for Charcot-Marie-Tooth (CMT) disease type I 9 Dr. B.M. Cattanach 1 Dr. J. Peters or Genetics, MRC Radiobiology Unit Dr. Y. Boyd (a) Mapping the regions of mouse chromosome 2 that are subject to parental imprinting (b) The comparative genetic organisation of sequences conserved between man and mouse To be chosen from: 10 R.D.A. Hopkinson 1 Dr. C. Abbott or MRC Human Biochemical Professor E.B. Robson Genetics Unit and Genetics Dr. B. Carritt or and Biometry UCL (a) Cloning developmental mutant genes on mouse chromosome 2 (b) Physical mapping and organisation of human Rhesus gene Dr. J.D.A. Delhanty (c) Detailed mapping of human chromosome 9q with particular reference to the isolation of the gene for tuberous sclerosis Dr. D.M. Swallow or (d) Determination of gene order within a closely linked gene cluster on human chromosome 11p15, which includes HRAS, INS HBB and MUCZ by family genetic methods Prof. E.B. Robson (e) Linkage map of chromosome 1 or Dr. J. Wolfe (f) Construction of a contig map of the human Y chromosome 11 Professor E. Southern 1 Dr. W.R.A. Brown Biochemistry, Oxford Telomere directed chromosome breakage as a tool in human genome mapping 12 Dr. N.A. Roseneyer 1 Dr. J. Thornton Biochemistry and Molecular Biology, University College London Protein sequence and structure analysis using an integrated database of sequence and structural data 13 Dr. S.S. Bhatlacharya 1 M.Sc studentship Molecular Genetics Unit for Medical Newcastle upon Tyne Genetics Course APPENDIX I: List of Contributors Dr. Nigel K. Spurr Imperial Cancer Research Fund Clare Hall Laboratories Blanche Lane South Mimms, Potters Bar, Herts. EN6 3LD Tel.No: 0707-44444 Ext. 353 Fax: 0707-49527 Tony Vickers HGMP Resource Centre Watford Road Harrow Middlesex HA1 3UJ Tel.No: 081-869 3809 Fax: 081-869 3807 MRC Clinical Research Centre (Director: Dr. K.E. Kirkham OBE) Watford Road Harrow Middlesex HA1 3UJ Tel.No: 081-869 3232 Fax: 081-423 1275 Heads of Divisions and Sections involved in molecular genetics: Dr. C. Danpure, Biochemical Genetics Research Group Dr. M. Farrall, Division of Molecular Medicine Dr. S. Rastan, Division of Comparative Biology Dr. J. Scott, Division of Molecular Medicine Dr. E. Simpson, Section of Transplantation Biology Dr. R. Thakker, Division of Molecular Medicine, Mineral and Endocrine Disorders Research Group Dr. E. Tuddenham, Haemostasis Research Group Dr. A. Vickers, human Genome Mapping Project Resource Centre Dr. R. Winter, Division of Molecular Medicine [Clinical Genetics (Dysmorphology) Research Group] Dr. P. Woo, Section of Molecular Rheumatology Imperial Cancer Research Fund P.O. Box 123 Lincoln's Inn Fields, London WC2A 3PX Tel.No: 071-242 0200 Fax: 071-405 1556 Laboratory of Human Molecular Genetics (Dr. Peter Goodfellow) Human Immunogenetics Laboratory (Dr. John Trowsdale) Genome Analysis Laboratory (Dr. Hans Lehrach) Human Cytogenetics Laboratory (Dr. Denise Sheer) Molecular Analysis of Mammalian Mutation Laboratory (Dr. A-M. Frischauf) Charing Cross Hospital (Dr. Keith Johnson) Department of Anatomy Charing Cross and Westminster Medical School Fulham Palace Road London W6 8RF Tel.No: 071-846 7038 Fax: 071-846 7025 St. Bartholomew's Hospital (Professor David J. Galton) Department of Human Genetics and Metabolism (Diabetes and Lipid Laboratory) St. Bartholomew's Hospital West Smithfield London EC1A 7BE Tel.No: 071-601 8888 Ext. 8432 Fax: 071-601 8042 St. Mary's Hospital Medical School (Professor Bob Williamson/Dr. Peter Scambler) Cystic Fibrosis Research Group Department of Biochemistry & Molecular Genetics St. Mary's Hospital Medical School Norfolk Place London W2 1PG Tel.No: 071-723 1252 Fax: 071-706 3272 Institute of Child Health (Dr. Sue Malcolm) Mothercare Department of Paediatric Genetics Institute of Child Health University of London 30 Guilford Street London WC1N 1EH Tel.No: 071-242 9789 Fax: 071-831 0488 Mount Vernon Hospital (Dr. Janet Arrand) Molecular Biology Group CRC Gray Laboratory P.O. Box 100 Mount Vernon Hospital Northwood Middlesex. HA6 2JR Tel.No: 09274-28611 Fax: 0923-835210 The Galton Laboratory, University College London The Galton Laboratory University College London Wolfson House 4 Stephenson Way London NW1 2HE Tel.No: 071-387 7050 Fax: 071-387 3496 Comprising the MRC Human Biochemical Genetics Unit (Director Dr. D. Hopkinson) and the Department of Genetics and Biometry, University College London (Head of Department Dr. J.S. Jones). University College & Middlesex School of Medicine a) Dr. Georg Melmer Department of Psychiatry Wolfson Building Riding House Street London W1N 4LJ b) Professor J.L.H. O'Riordan Department of Medicine University College and Middlesex School of Medicine Middlesex Hospital Mortimer Street London W1N 8AA Royal Postgraduate Medical School, Hammersmith Hospital (Dr. L. Luzzatto) Department of Haematology and MRC/LRF Leukaemia Unit Royal Postgraduate Medical School Hammersmith Hospital Ducane Road London W12 0NN Tel.No: 081-740 3234 Fax: 081-740 9679 United Medical and Dental Schools of Guy's & St. Thomas's Hospitals (Prof. M. Bobrow) Paediatric Research Unit Division of Medical and Molecular Genetics United Medical and Dental Schools of Guy's and St. Thomas's Hospitals Prince Philip Research Laboratories 7th & 8th Floors, Guy's Tower Guy's Hospital London SE1 9RT Tel.No: 071-955 4456 Fax: 071-955 4644 Institute of Neurology (Professor Louis Lim & Dr. Christine Hall) Department of Neurochemistry Institute of Neurology 1, Wakefield Street, London WC1N 1PJ Tel.No: 071-278 1552 Fax: 071-278 7045 London School of Hygiene and Tropical Medicine (Dr. Neil Stoker) Department of Clinical Sciences London School of Hygiene and Tropical Medicine Keppel Street London WC1E 7HT Tel.No: 071-636 8636 Fax: 071-436 5389 Imperial College of Science Technology and Medicine Dr. Peter Little Dept. of Biochemistry Imperial College London SW7 2AZ Tel.No: 071-823 7518 Fax: 071-823 7525 THE EUROPEAN COLLABORATIVE INTERSPECIFIC BACKCROSS - A FACILITY FOR MAPPING THE MOUSE GENOME Dr. Stephen Brown Dept. of Biochemistry and Molecular Genetics St. Mary's Hospital Medical School London W2 1PG Tel.No: 071-723 1252 Ext. 5484 Fax: 071-706 3272 OLIGONUCLEOTIDE PRIMERS FOR PCR ANALYSIS OF MOUSE MICROSATELLITES C. Hearne, M. McAleer, J. Love, A. Knight, T. Aitman, R. Cornall, J.-B. Prins, S. Ghosh and J. Todd Nuffield Dept. of Surgery John Radcliffe Hospital Headington Oxford OX3 9DU Tel: 0865-220145 FAX: 0865-68876 APPENDIX II MOUSE CHROMOSOME SPECIFIC MICROSATELLITES ------------------------------------------------------------------------ Sequence Locus Chromosome Primer sequences (map location,cM) ------------------------------------------------------------------------ PCR Repeat unit Size variation; product Mg2+/annealing temp. size (bp) (mM) (C) ------------------------------------------------------------------------ 50.MUSACHRA Acrg 1(17) ACCGTTCACAGCTGACCTAGT GGGACACAGATGTACTAAGCT 112 (CA)12 B6/J=B6.PL>NON=DBA/2J=NOD=B10/W>SPE 4/55 *119.M22871 Crp 1(71) AGAATCTGACTTACCCATGGT GAGGGAGAAGAATTATGTCTG 143 (AT)12 NOD=NON>SPE=DBA/2J>B6/J=B10/W; 4/55 *73.MMADAP Ada 2(67) CCGGGAAATGCGCGCCAGAGT GGTCGCTTCCCGATGGCTCTCAGA 174 G22 NOD=B10/W=B6/J=NON=DBA/2J=AKR/J>SPE; 2/55 *138.MMIL01 Il-2 3(15) GTGCTCCTTGTCAACAGCGCA CTCCTGTAGGTCCATCAACAGC 129 (CAG)12 B10/J>>SPE; 1/55 *89.MUSTSHBA2Tshb 3(63) TCTGAAGAGTTTGTCCTCATC TGAATAAAGGACTCCTGAGCT 158 T27 NOD=AKR/J>B10/W=NON=B6/J=DBA/2J>SPE; 2/55 81.MUSAGP1A Orm-1 4(38) TTCTGGCCAACCTCTGTGCTT CCCACAGTTGTCCTGTGACAT 132 (GT)28 B6.PL=B10/W>DBA/2J=NON=NOD>SPE; AGAROSE *216. Lck 4(57) GCAGATGGAATTCCTGTGCCA ACACACAGAGACATGAGATTGGAT 340 HaeIII digestion SPE,NOD,DBA/2J,AKR,NON allele 1; B6/J,B10/W,B6.PL allele 2; 1/55 106.MMIL6A Il-6 5(11) TGTATAGAGCCCAATAAAGTG ACCATGCCCAGCCTAATCTAG 81 (CA)X SPE>B10/W=NOD=B6/J=NON=DBA/2J; 2/55 70.MMFTPR Afp 5(46) AGCAGGGCTACACAGAGAAAC ATTCCCATATTTGCATCTCCA 95 A38 NOD=DBA/2J>B10/W=B6/J>NON>SPE; 5/55 19.MMNGFG2 Ngfg 7(21) CTCCACATGTGTATGTGTATG ATGGAGGCCGAAGAAAGAATC 147 (TC)26 SPE>B6.PL=B10/W>NOD=NON; 1/60 9.MMINT2 Int-2 7(74) GTGACAATACATTCCTGCTGT CTCAGATCTTATCTCTAGCAC 161 (GT)23 B10/W=NOD=B6/J=NON=B6.PL>SPE>DBA/2J; 2/55 25.MMCD46 Ly-4 6(56) AGGAGAGGATTAACTCTTGAA CATGCATGTGTGCAACATGCG 123 (CA)11 B6/J=DBA/2J=NOD=NON=CBA=B6.PL= B10/W>> SPE; 2/55 10.MMMETII Mt-2 8(35) CATGCAGAAGCATGCATTGGTCA AAGCTTACGGTTTAATCC 121 (TG)24 NOD>B10/W=NON=B6/J= DBA/2J>SPE; 3/55 34.MMCYO3 Cypla2 9(28) AGTTTTAGGCTAGTATAGGTT ACTGGAACCTTAGAGCATGAG 198 (CAAG)11 SPE>B10/W=B6.PL=B6/J=NON>NOD=DBA/2J; 1/55 4.MMGLN1 Glns 11(10) AGCTTTGGAGACAACAATTAGATC TGTTCATCAGCTGAGGAATGGATG 181 (GT)20 SPE>B6/J=B6.PL=B10/W>NOD=DBA/2J; 1/55 5.MMHOX23R Hox-2 11(54) CCTTGCATTCTGAGGCTGAAGGAC TCAGAAGTCTTGCGCTGCATC 218 (GT)24 SPE>B6.PL=B10/W=NON=NOD>DBA/2J; 1/55 *140.MMODCC Odc 12(4) CATTTGAGGACAGTCAGGATC GGAACTTTCATGCAGTACTAG 175 POLY T NOD>NON=AKR/J=DBA/2J>>B6/J=B10/J>>SPE; 2/55 1.MMIGVH16 Igh-V 12(73) ACATGGTAATTTATGGGCAA CTGGATACCTGCAATAGTAGA 148 (GT)28 B6/J=NOD=B6.PL=B10/W>NON=SPE>DBA/2J; 3/55 29.MMUPAA Plau 14(5) TGCTGGCTAGGAATAAACAGA AGGGAATTCATGTTCAGGATA 188 (GA)29 DBA/2J>SPE=NON=NOD>B6.PL=B10/W=B6/J; 2/55 *120. hr 14(27) CCACCCTGGAATCTTCCGTGA TTGCTGTGGAGAGTGCGTGCA 143 (GT)16 CBA=DBA=B6/J=AKR=B10/J=C3H=SWR=NOD; 1.5/55 13.MMMYCE12 Myc 15(18) CGTCACTGATAGTAGGGAGTA TCAGCGTGCTGTACTTCCAAG 107 (CA)20 B6.PL=B6/J=B10/W=DBA/2J=NON>NOD; 1/55 B6/J>>SPE(50C) 43.MMHOX31R Hox-3 15(48) TTCCTGCTCCCACCTTCTGAG GAATCATCTTCTATATCTTCAGG 166 (CA)19 SPE>B10/W=B6.PL=B6/J=NON>NOD=DBA/2J; 1/55 *192.TJ+2.133D16Nds2 16(49) ATTGGTGAGCTTACAGAATAC GTGGTCATGATATTCGTAGAT 90 (CA)23 DBA/2J>>B10/W=B6.PL=B6/J>>NOD= NON=AKR/J>SPE; 1/55 22.MMTNFAB Tnfb 17(19) TTCCTGTGGCGGCCTTATCAG AGACAATGGGTAACAGAGGCA 135 (TC)28C2(TC)12 B6/J=B6.PL>B10/W=NOD=NON=DBA/2J>SPE; TT(CT)5 1/55 36.MMBPS2 Mbp 18(57) CAGTACAGCCAGGACACAGAA ATGGCTGACCAACTCTCTAGC 144 (CA)17 SPE>NOD=B6.PL=B10/W=CBA=B6/J=DBA/2J=NON; 1/55 *121.MMIIGC Ii 18 GGTGCCAAATGGTCAGTCCTG GCTTCACTTCAAATTCATGGC 158 (AT)6 B6.PL>NON>SPE>B10/W>NOD=B6/J=DBA/2J; 1.5/55 26.MMREPGT4 Hprt X(23) TGACAACTTCTGTCCTCAACA ATGCCGTCCTTTATCTAGAAC 97 (CA)14 SPE>NOD=NON>B6.PL=B10/W=CBA=DBA/2J=B6/J; 4/55 11.MMPLP7A Plp X(56) TAATATAACAGATAACCAACCATTC CATTTTGTAAGATGAGTTTCTA 120 (CA)13 SPE>>CBA=NOD=NON=B6.PL=B10/W=B6/J=DBA/2J; 2/55 >> = agarose resolvable * unpublished data -- GARY WILLIAMS, Computing Services Section, Janet: G.Williams@UK.AC.CRC MRC-CRC & Human Genome Mapping Centre, Internet: G.Williams@CRC.AC.UK Watford Rd, HARROW, Middx, HA1 3UJ, UK EARN/Bitnet: G.Williams%CRC@UKACRL Tel 081-869 3294 Fax 081-423 1275 Usenet: ...!mcsun!ukc!mrccrc!G.Williams