Xref: utzoo bionet.molbio.genbank:442 sci.bio:4878 Newsgroups: bionet.molbio.genbank,sci.bio Path: utzoo!utgpu!news-server.csri.toronto.edu!rpi!zaphod.mps.ohio-state.edu!magnus.acs.ohio-state.edu!csn!boulder!boulder!eesnyder From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder) Subject: Software for automated subseqence extraction Message-ID: Sender: news@colorado.edu (The Daily Planet) Nntp-Posting-Host: beagle.colorado.edu Organization: University of Colorado, Boulder Date: 27 Apr 91 18:29:32 GMT Lines: 17 I am looking for some software that will allow me to extract subsequences from genbank or PIR. For example, I would like to be able to provide a keyword such as 'splice site' and have the program search genbank and return with a list of sequence names and the subsequence from each entry corresponding to my keyword. Any leads would be appreciated.... Thanks, --------------------------------------------------------------------------- TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG Eric E. Snyder Department of MCD Biology ...making feet for childrens' shoes. University of Colorado, Boulder Boulder, Colorado 80309-0347 LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu ---------------------------------------------------------------------------