Path: utzoo!utgpu!news-server.csri.toronto.edu!cs.utexas.edu!sdd.hp.com!elroy.jpl.nasa.gov!jpl-devvax!lwall
From: lwall@jpl-devvax.jpl.nasa.gov (Larry Wall)
Newsgroups: comp.lang.perl
Subject: Re: global pattern matching question
Message-ID: <1991May4.010307.11792@jpl-devvax.jpl.nasa.gov>
Date: 4 May 91 01:03:07 GMT
References: <JES.91May3121528@mbio.med.upenn.edu>
Reply-To: lwall@jpl-devvax.JPL.NASA.GOV (Larry Wall)
Distribution: comp
Organization: Jet Propulsion Laboratory, Pasadena, CA
Lines: 64

In article <JES.91May3121528@mbio.med.upenn.edu> jes@mbio.med.upenn.edu (Joe Smith) writes:
: 
: I'm experimenting with perl to find patterns in DNA sequences.  So
: far, the experiment is partially successful.  Can anyone suggest
: improvements?  The DNA is represented by a long scalar string
: (5000-10,000 characters is not uncommon), in which I want to find
: instances of a pattern.  Here's a first draft:
: 
: #!/usr/local/bin/perl
: 
: # a test sequence
: $seq =  'TATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCG' .
: 	'CCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGT' .
: 	'TCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCC' ;
: 
: # now the search...
: $n = ($seq =~ s/(CC[AT]+)/
: 	push(@sites, $1),			# record the actual match
: 	push(@positions, length $`),		# and it's position (1)
: 	$1/gei					# don't change anything (2)
: );
: 
: print "$n sites:\n";
: for ($[..$#sites) {
: 	print "  $_: $positions[$_], '$sites[$_]'\n";
: }
: __END__
: 
: Here's what I get:
: 
: 7 sites:
:   0: 0, 'CCAA'
:   1: 0, 'CCTT'
:   2: 0, 'CCTTT'
:   3: 0, 'CCA'
:   4: 0, 'CCTT'
:   5: 0, 'CCAA'
:   6: 0, 'CCT'
: 
: Note that
: 
:   1) The 'length $`' doesn't seem to work while the search is going
:      on.  Keeping track of the positions that matched is critical, and
:      carving the sequence into substrings is likely to be messy and
:      slow.  Did I miss something simple?  Would it be possible/useful
:      to have perl update a variable with the offset of the beginning
:      of the match?

In 4.003, $` is unfortunately broken within s/// because of a fix to
something else.  That'll be fixed in patch 4.  As a workaround you
could use length($seq) - length($')  - length($1).  Yeah, blech...

Alternately, you could use split.

:   2) Having to replace the matched pattern with itself seems very
:      inefficient, (especially when processing a 10Kb string!).  Is
:      there any way of doing a similar operation with m//, or perhaps
:      tricking s/// into not doing any replacement?

An option to s/// not to do replacement would be interesting, though
there might be a better way--maybe an initial offset for m//, or
allowing patterns in index().

Larry