Path: utzoo!utgpu!news-server.csri.toronto.edu!rpi!zaphod.mps.ohio-state.edu!sdd.hp.com!spool.mu.edu!ox.com!msen.com!emv From: frist@ccu.umanitoba.ca Newsgroups: comp.archives Subject: [genbank] GETOB - A GenBank Features Extraction Program Message-ID: <1991May9.011800.18868@ox.com> Date: 9 May 91 01:18:00 GMT Article-I.D.: ox.1991May9.011800.18868 Sender: emv@msen.com (Edward Vielmetti, MSEN) Reply-To: frist@ccu.umanitoba.ca Followup-To: bionet.molbio.genbank Organization: University of Manitoba, Winnipeg, Canada Lines: 195 Approved: emv@msen.com (Edward Vielmetti, MSEN) X-Original-Newsgroups: bionet.molbio.genbank Archive-name: bionet/molbio/getob/1991-05-03 Archive-directory: ccu.umanitoba.ca:/pub/psgendb/ [130.179.16.8] Original-posting-by: frist@ccu.umanitoba.ca Original-subject: GETOB - A GenBank Features Extraction Program Reposted-by: emv@msen.com (Edward Vielmetti, MSEN) ***************************************************************************** GETOB - A GenBank Feature Extraction Program Brian Fristensky, PhD University of Manitoba Winnipeg, CANADA ***************************************************************************** Since there have been a number of requests recently for programs that can extract subsequences using the GenBank/EMBL/DDBJ Features Table Format, I am posting this announcement to those who may benefit from such a program. GETOB is a Pascal program that can evaluate any legal FEATURES expression, and write the result to an output file. It is an extremely versatile and complete tool that was written as part of my XYLEM package. The XYLEM package is a general purpose set of tools for maintaining and manipulating complete databases (eg. GenBank, PIR, EMBL, VecBase, LiMB) or subsets of these databases. XYLEM makes it possible to retrieve entries from databases by name, accession number or keyword; to create database subsets; to extract features from GenBank entries. Tools are provided to perform operations on database subsets, such as randomization or translation. Partly due to my teaching load, and partly due to keeping up with changes in the Features definition, I don't yet have all the documentation written to formally release XYLEM to the world at large. I hope to be able to do this in the next couple of months. However, to those who need a GenBank parser NOW, this may be your ticket. ------------------- WHAT GETOB CAN DO Given a namefile containing GenBank LOCUS names or ACCESSION numbers, such as POTPR1A POTPSTH2 POTPSTH21 POTSTHA and an instruction file containing commands telling GETOB what features to get, (eg. CDS, mRNA, stem_loop, prim_transcript... in short any legal feature), GETOB will create those features for each entry listed, in namefile, and write them to an output file (outfile). For example, the CDS (protein coding sequence)for the first sequence specified in namefile would be written to outfile as: >POTPR1A:1 atggcagaagtgaagttgcttggtctaaggtatagtccttttagccatag agttgaatgggctctaaaaattaagggagtgaaatatgaatttatagagg aagatttacaaaataagagccctttacttcttcaatctaatccaattcac aagaaaattccagtgttaattcacaatggcaagtgcatttgtgagtctat ggtcattcttgaatacattgatgaggcatttgaaggcccttccattttgc ctaaagacccttatgatcgcgctttagcacgattttgggctaaatacgtc gaagataag ggggcagcagtgtggaaaagtttcttttcgaaaggagaggaacaagagaa agctaaagaggaagcttatgagatgttgaaaattcttgataatgagttca aggacaagaagtgctttgttggtgacaaatttggatttgctgatattgtt gcaaatggtgcagcactttatttgggaattcttgaagaagtatctggaat tgttttggcaacaagtgaaaaatttccaaatttttgtgcttggagagatg aatattgcacacaaaacgaggaatattttccttcaagagatgaattgctt atccgttaccgagcctacattcagcctgttgatgcttcaaaatga A second file, containing a log of operations performed in evaluating the Feature experession, would look like this: GETOB Version 0.94 1 May 1991 POTPR1A:1 join ( 295 603 1011 1355 ) /note="pathogenesis-related protein (prp1)" /codon_start=295 //---------------------------------------------- In the example, the CDS from entry POTPR1A has been written in two chunks, corresponding to the two exon portions of the coding sequence. Each location retrieved in constructing the object is written as a separate chunk of sequence. This makes it easier to see the different pieces that were put together to form the final product. (One additional point: outfile format is directly compatible with Bill Pearson's FASTA programs.) By comparing message file to outfile, human intervention is possible. This can be very important in 1) catching errors in the database (not uncommon, but the GenBank staff will never be able to find and correct these errors unless YOU report them!) 2) errors in the program (none that I know about, but this is a very complex program) 3) things you don't really want (eg. pseudogenes, which will be documented in the qualifier lines). GETOB can also be used to get specific labeled objects from a given entry. Examples: @k30576:polyprotein @k30576:/label=polyprotein @x10345:/product="hsp70" @j00879:group(1..2200,mutation_37) The first two constructs given above are equivalent. Both will extract the feature called polyprotein. The third construct shows that any feature label can be specified. If none is specified, as in the first example, then /label= is assumed. One limitation, however, is that the label sought must be unique within the entry in its first 15 characters including double quotes ("). Otherwise, only the first matching label expression will be evaluated. Finally, the last example shows that a mutant sequence can be constructed by first specifying an expression that evaluates to a sequence (ie. 1..2200) and then a labeled expression that upon evaluation, uses replace() to modify that sequence. The usage shown in examples 3 & 4 above represent extensions to the DDBJ/EMBL/GenBank Features Table Format. ------------------- CAVEATS THAT MAY KEEP YOU FROM GOING RIGHT OUT AND GETTING THE PROGRAMS 1) At present, the only documentation available is in the form of Unix manual pages. In the future, I hope to have a readable User's Guide available, with lots of examples. I simply haven't had time to write this yet! 2) To run GETOB, you need to compile the entire XYLEM Package. XYLEM has so far only been run under SUN and ATT SysV Unix. For systems on which the c-shell is available, shell scripts are provided that automate the installation process. 3) GETOB reads entries in GenBank flat-file (tape) format, with one qualification: annotation and sequence are split between separate files, with an index file logically linking the two. Thus, to use GETOB you have to be able to generate a database subset containing canonical GenBank flatfile entries, and then use splitdb to reorganize the data as described. A future version of GETOB may be able to directly read GenBank files with both annotation and sequence together, but for now you need to do things within the context of XYLEM. In fact, XYLEM is intended for maintanence of complete databases (GenBank, EMBL, PIR, VecBase, LiMB), and you may wish to use it as your general database package. 4) At present, all XYLEM programs are written to behave as Unix commands, which makes them not terribly user-friendly. For example, the syntax for getob is getob [-frcn] infile namefile anofile seqfile indfile message outfile An X-Windows front end is currently under development, and a menu-driven shell script is provided that makes retrieval of database entries very easy. 4) Non-Unix systems These programs adhere religiously to Standard Pascal, and are written with portability in mind. The only non-standard features are file I/O calls which are carefully isolated in specialized subroutines. A programmer's guide is included with a step-by-step instructions for adapting the programs to different Pascal compilers, with the help of Tom Schneider's module program. 5) At present, GETOB only works with GenBank entries. Since EMBL and DDBJ also use the same Features format, it should be easy to adapt GETOB to read these databases as well. I just haven't gottin around to doing it yet. -------------------------- HOW TO GET GETOB AND XYLEM The XYLEM Package can be obtained by anonymous FTP from ccu.umanitoba.ca. XYLEM is stored as a compressed tar file in the directory /var/spool/ftp/pub/psgendb If you don't know how to use FTP, send me a message and I'll mail you instructions. =============================================================================== Brian Fristensky | Department of Plant Science | "There's a big ... machine in the sky... University of Manitoba | some kind of electric snake... coming Winnipeg, MB R3T 2N2 CANADA | straight at us." frist@ccu.umanitoba.ca | "Shoot it," said my attorney. Office phone: 204-474-6085 |"Not yet," I said,"I want to study its habits" FAX: 204-275-5128 |H.S. Thompson, FEAR & LOATHING IN LAS VEGAS =============================================================================== -- comp.archives file verification ccu.umanitoba.ca total 354 -rw-r--r-- 1 530 124037 May 5 17:25 xylem.tar.Z -rw-r--r-- 1 530 1355 May 3 21:30 README -rw-r--r-- 1 530 211789 May 3 20:05 fsap.tar.Z found getob ok ccu.umanitoba.ca:/pub/psgendb/