Relay-Version: version B 2.10 5/3/83; site utzoo.UUCP
Path: utzoo!utgpu!water!watnot!watmath!clyde!rutgers!mit-eddie!genrad!decvax!decwrl!pyramid!prls!philabs!aecom!werner
From: werner@aecom.UUCP
Newsgroups: sci.bio
Subject: Re: question
Message-ID: <1001@aecom.UUCP>
Date: Fri, 3-Apr-87 00:00:17 EST
Article-I.D.: aecom.1001
Posted: Fri Apr  3 00:00:17 1987
Date-Received: Sun, 5-Apr-87 10:02:46 EST
References: <11189@teknowledge-vaxc.ARPA> <978@aecom.UUCP> <3310@udenva.UUCP>
Organization: Albert Einstein Coll. of Med., NY
Lines: 33

In article <3310@udenva.UUCP>, agranok@udenva.UUCP (Alexander Granok) writes:
> >
> base pair by itself doesn't do much good.  But, if a base pair is a bit, then
> what is a nucleotide?  I guess it all depends on what you mean by "informa-
> tion."   

 	For DNA, base pair and nucleotide are interchangable terms, so I
had to laugh at the above.  Each base is a nucleotide, and since DNA is
complementary, each base automatically specifies the one across from it.
The same cannot be said for RNA, which is single-stranded.

	For instance the partial sequence of of the recombinant
plasmid, pBmCW5, reads:


	5'ATAGCTGATGCAAGATGAAGCTCTTGG3'

	From that I can read the complementary strand effortlessly
	5'CCAAGAGCTTCATCTTGCATCAGCTAT3'

so that the whole thing becomes:

	5'ATAGCTGATGCAAGATGAAGCTCTTGG3'
        3'TATCGACTACGTTCTACTTCGAGAACC5'

(and yes, the CW in pBmCW5 stands for Craig Werner)


-- 
			      Craig Werner (MD/PhD '91)
				!philabs!aecom!werner
              (1935-14E Eastchester Rd., Bronx NY 10461, 212-931-2517)
                          "I just won't sleep, that's all."