Path: utzoo!utgpu!watmath!uunet!bionet!net.bio.net!kristoff From: kristoff@NET.BIO.NET (Dave Kristofferson) Newsgroups: bionet.general Subject: New Network Service from BIONET - FASTA-MAIL Similarity Searches!! Message-ID: Date: 9 Jan 89 22:16:38 GMT Sender: kristoff@NET.BIO.NET Lines: 206 IMPORTANT INFORMATION - PLEASE SAVE FOR FUTURE REFERENCE!!! As part of our efforts to provide easier access to the BIONET resource and reduce communications costs, we are pleased to announce the availability of a new service to the scientific community. The BIONET FASTA-MAIL program for nucleic acid and protein sequence database similarity searches is now available on an experimental basis to academic and other non-profit users with electronic mail access to the BIONET computer, net.bio.net. This should include users on the Internet, BITNET, EARN, NETNORTH, and JANET. To access this program, it is first necessary to register with BIONET by sending an electronic mail message to one of the following addresses: fasta-req@net.bio.net (from Internet/BITNET/EARN/JANET/NETNORTH) ...!{backbone}!bionet!fasta-req (via UUCP) If you are connected to the networks via UUCP, you must find a mailpath to bionet. PLEASE INCLUDE IN THE MESSAGE A DESCRIPTION OF YOUR PROFESSIONAL POSITION TO ASCERTAIN THAT YOU ARE INDEED ENGAGED IN NON-PROFIT RESEARCH. When you receive confirmation of registration by return e-mail, you will be given an address to access the FASTA-MAIL program. Directions for use are given below. There is no fee for the use of the program, but outside users are on their own. BIONET does not have the resources to provide technical support to scientists who do not have accounts on the BIONET computer. Although you must interpret your own results (see references below), we will respond to problems with the program (mail to fasta-req@net.bio.net). To ensure that outside users of the FASTA-MAIL program do not drain computer resources from our regular BIONET subscribers, jobs submitted from other computers will be placed in a low priority queue. This queue can be monitored by sending mail to fasta-q@net.bio.net. BIONET will NOT answer questions about job turnaround times. Also please note that the program will only allow ONE JOB per registered user in the queue AT ANY TIME. NOTE(!!): If you submit a second job while your first job is still in the queue, your first job will be automatically canceled!! I would like to thank both Eliot Lear, one of BIONET's systems programmers, for his fine work in developing FASTA-MAIL, and Dr. William Pearson at the University of Virginia, the author of the original FASTA program. Sincerely, David Kristofferson, Ph.D. BIONET Resource Manager kristoff@net.bio.net or kristofferson@bionet-20.bio.net ---------------------------------------------------------------------- HOW TO USE FASTA-MAIL FROM OUTSIDE OF BIONET To use the FASTA-MAIL service, simply register as described above and then send a mail message to the batch server with the following information in the body of the message (mailing address is supplied to registered users). Please follow this format PRECISELY, but note that the program is case-insensitive, i.e., either upper or lower case letters may be used. Please note that the syntax is rather inflexible, as this is an initial version of the code. (There will be improvements later). An example is provided at the end of this message. Note that "{your sequence data here}" refers only to the position and is NOT a requirement to enclose the data in braces, {}. Sequence data should be limited to no more than 80 characters per line. DATALIB database-name KTUP ktup-val BEGIN {your sequence data here} The value "database-name" is the name of the database to be searched and is selected from the left-hand column in the following table. database-name Description ------------- ----------- pir Protein Identification Resource swiss-prot SWISS-PROT Protein Database embl entire EMBL nucl. acid seq. database genbank/primate Primate Section of Genbank genbank/rodent Rodent ... genbank/other_mammalian Mammal ... genbank/other_vertebrate Vertebrate ... genbank/invertebrate Invertebrate ... genbank/plant Plant ... genbank/organelle Organelle ... genbank/bacterial Bacterial ... genbank/structural_rna Structural RNA genbank/viral Viral genbank/phage Phage ... genbank/synthetitic Sythetic genbank/unannotated Unannotated genbank/bacterial Bacteria genbank/all Entire Genbank The value "ktup-val" is the k-tuple value as defined in Pearson and Lipman's paper: Pearson, W.R., and Lipman, D.J. (April 1988). "Improved tools for biological sequence comparison." Proc. Natl. Acad. Sci., Vol. 85, pp. 2444-2448. Typical values for ktup-val are 4 for nucleic acid searches and 2 or 1 for protein searches. Sequence data must be in either Pearson's FASTA format or IntelliGenetics format. Please no more than 80 characters per line! Pearson format (a comment line beginning with a > followed by the sequence data): >AGMREP4 - Monkey SV40-like genomic segment promoting transcription. ccccttcaaatctattacaaggtgagcgtctcgccaaggcaatgaaatcgcaatatgatg tttccatttactttggattatacgtcattataaatattaacaaataagactcaaaaagga caccttcgggtaggtcagaccaaagtacaaaacttgtgtgtggggctgcagtttgagggc agtgtctgcagccgtcacatggtagcaaaacggtgttaagcagcgcacgagagtctgcgt cgaccacagccagagtccatgcatcgggaggttcactcggtttgcgaagaacgggcaggg catgcacggcctgggctcggcgggcgggcgggcgggccggggcgcagttccccaggttcg ccactagaggtcaggaggtgaccgcttcggggctggaagacgggcccgtcgtggattggc tagtgccggcggagggcggggcggagagtggggcggggcggagagtggggcggggcgcag ttccccaggttcgccactagaggtcaggaggtgaccgcttcggggcgggaagactggccc gtcggggattggctagtgccggcggggggcggggcggggggcggagggcggggtggacgt ggcgcctggttgctgacatctggaatgacttttttttggcatcagatttcctgtctttgt ggggctgatggacccgagtaaagatgcccgttcggggtcaaaggcagagccgcttctgca gcttctcaaagc IntelliGenetics format: ;Comment lines (optional) start with a semicolon, e.g., ;Monkey SV40-like genomic segment promoting transcription. ;Sequence data ends in a 1 (below) if linear or ;a 2 if circular. ;Next line (first non-optional line) is the sequence name. AGMREP4 ccccttcaaatctattacaaggtgagcgtctcgccaaggcaatgaaatcgcaatatgatg tttccatttactttggattatacgtcattataaatattaacaaataagactcaaaaagga caccttcgggtaggtcagaccaaagtacaaaacttgtgtgtggggctgcagtttgagggc agtgtctgcagccgtcacatggtagcaaaacggtgttaagcagcgcacgagagtctgcgt cgaccacagccagagtccatgcatcgggaggttcactcggtttgcgaagaacgggcaggg catgcacggcctgggctcggcgggcgggcgggcgggccggggcgcagttccccaggttcg ccactagaggtcaggaggtgaccgcttcggggctggaagacgggcccgtcgtggattggc tagtgccggcggagggcggggcggagagtggggcggggcggagagtggggcggggcgcag ttccccaggttcgccactagaggtcaggaggtgaccgcttcggggcgggaagactggccc gtcggggattggctagtgccggcggggggcggggcggggggcggagggcggggtggacgt ggcgcctggttgctgacatctggaatgacttttttttggcatcagatttcctgtctttgt ggggctgatggacccgagtaaagatgcccgttcggggtcaaaggcagagccgcttctgca gcttctcaaagc1 Once we receive your message on our machine, it is placed in a batch queue. It will be processed in the order it is received. Please note that we are only allowing one job per user in the queue. If you have submitted one job, don't submit another before receiving your results back or the previous job will be cancelled. Your position in the queue can be monitored by mailing to fasta-q@net.bio.net. An example follows. Please note that the first four lines below are a mail header which is automatically created when you address a mail message. The From: and To: addresses are completely fictious. Nothing need be entered as a Subject: for the message. The text that you enter into the body of the mail message begins with DATALIB. From drbob@someaddress.somewhere.edu Tue Jun 14 21:36:38 1988 Date: 14 Jun 1988 2129:02-PDT To: xxxxx@net.bio.net Subject: Batch Job DATALIB GenBank/other_mammalian KTUP 4 BEGIN >BOVPRL GenBank entry BOVPRL from omam file. 907 nucleotides. TGCTTGGCTGAGGAGCCATAGGACGAGAGCTTCCTGGTGAAGTGTGTTTCTTGAAATCAT CACCACCATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGT GGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCCACCCCCGTCTGTCCCAATGGGCC TGGCAACTGCCAGGTATCCCTTCGAGACCTGTTTGACCGGGCAGTCATGGTGTCCCACTA CATCCATGACCTCTCCTCGGAAATGTTCAACGAATTTGATAAACGGTATGCCCAGGGCAA AGGGTTCATTACCATGGCCCTCAACAGCTGCCATACCTCCTCCCTTCCTACCCCGGAAGA TAAAGAACAAGCCCAACAGACCCATCATGAAGTCCTTATGAGCTTGATTCTTGGGTTGCT GCGCTCCTGGAATGACCCTCTGTATCACCTAGTCACCGAGGTACGGGGTATGAAAGGAGC CCCAGATGCTATCCTATCGAGGGCCATAGAGATTGAGGAAGAAAACAAACGACTTCTGGA AGGCATGGAGATGATATTTGGCCAGGTTATTCCTGGAGCCAAAGAGACTGAGCCCTACCC TGTGTGGTCAGGACTCCCGTCCCTGCAAACTAAGGATGAAGATGCACGTTATTCTGCTTT TTATAACCTGCTCCACTGCCTGCGCAGGGATTCAAGCAAGATTGACACTTACCTTAAGCT CCTGAATTGCAGAATCATCTACAACAACAACTGCTAAGCCCACATTCCATCCTATCCATT TCTGAGATGGTTCTTAATGATCCATTCCCTGGCAAACTTCTCTGAGCTTTATAGCTTTGT AATGCATGCTTGGCTCTAATGGGTTTCATCTTAAATAAAAACAGACTCTGTAGCGATGTC AAAATCT While we can not answer questions about interpretation of results, job turnaround times, etc., we will respond to any bug reports about the software. Please direct any problems to fasta-req@net.bio.net.