Path: utzoo!attcan!uunet!bionet!kristoff From: kristoff@genbank.BIO.NET (David Kristofferson) Newsgroups: bionet.software Subject: Re: How about try this, if FASTA Server error! Message-ID: Date: 7 Feb 90 21:03:41 GMT References: <9002062017.AA10475@net.bio.net> Organization: GenBank Online Service Lines: 21 The correct syntax for the FASTA-MAIL server follows. PLease follow it precisely. For complete instructions send a mail message containing just the word HELP (no Subject line) to search@genbank.bio.net. DATALIB GenBank/other_mammalian KTUP 4 SCORES 100 ALIGNMENTS 20 BEGIN >BOVPRL GenBank entry BOVPRL from gbmam file.907 nucleotides. tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat caccaccatggacagcaaa -- Sincerely, Dave Kristofferson GenBank On-line Service Manager kristoff@genbank.bio.net